Quick Order

Text Size:AAA

Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CDK1cDNA Clone Product Information
cDNA Size:894
cDNA Description:ORF Clone of Mus musculus cyclin-dependent kinase 1 DNA.
Gene Synonym:Cdc2, Cdc2a, p34, Cdk1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50892-ACG$325
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50892-ACR$325
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50892-ANG$325
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG50892-ANR$325
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50892-CF$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50892-CH$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50892-CM$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50892-CY$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone)MG50892-G$125
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50892-NF$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50892-NH$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50892-NM$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50892-NY$295
Mouse CDC2 Kinase / CDK1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50892-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

CDC2, also known as CDK1, contains 1 protein kinase domain and belongs to the protein kinase superfamily, CMGC Ser/Thr protein kinase family, CDC2/CDKX subfamily. CDC2 is a catalytic subunit of the highly conserved protein kinase complex known as M-phase promoting factor (MPF), which is essential for G1/S and G2/M phase transitions of eukaryotic cell cycle. Mitotic cyclins stably associate with CDC2 and function as regulatory subunits. The kinase activity of CDK1 is controlled by cyclin accumulation and destruction through the cell cycle. The phosphorylation and dephosphorylation of CDC2 also play important regulatory roles in cell cycle control. It is required in higher cells for entry into S-phase and mitosis. CDC2 also is a cyclin-dependent kinase which displays CTD kinase activity and is required for RNA splicing. It has CTD kinase activity by hyperphosphorylating the C-terminal heptapeptide repeat domain (CTD) of the largest RNA polymerase II subunit RPB1, thereby acting as a key regulator of transcription elongation. CDK1 is required for RNA splicing, possibly by phosphorylating SRSF1/SF2. It is involved in regulation of MAP kinase activity, possibly leading to affect the response to estrogn inhibitors.

  • Lee MG, et al. (1987) Complementation used to clone a human homologue of the fission yeast cell cycle control gene cdc2. Nature. 327(6117):31-5.
  • Enserink JM, et al. (2010) An overview of Cdk1-controlled targets and processes. Cell Division. 5(11): 1-41.
  • Ninomiya-Tsuji J, et al. (1991) Cloning of a human cDNA encoding a CDC2-related kinase by complementation of a budding yeast cdc28 mutation. Proc Natl Acad Sci. 88(20):9006-10.
  • Zhan Q, et al. (1999) Association with Cdc2 and inhibition of Cdc2/Cyclin B1 kinase activity by the p53-regulated protein Gadd45. Oncogene. 18(18):2892-900.
  • Jin S, et al. (2000) The GADD45 inhibition of Cdc2 kinase correlates with GADD45-mediated growth suppression. J Biol Chem. 275(22):16602-8.

    Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items