After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse TRIB3 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse TRIB3 cDNA Clone Product Information
Gene_bank_ref_id:NM_175093.2
RefSeq ORF Size:1065bp
cDNA Description:Full length Clone DNA of Mus musculus tribbles homolog 3 (Drosophila) with C terminal HA tag.
Gene Synonym:Nipk, SINK, Trb3, Ifld2, SKIP3, TRB-3, Trib3
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Tribbles homolog 3, also known as Neuronal cell death-inducible putative kinase, p65-interacting inhibitor of NF-kappa-B, SINK and TRIB3, is a Nucleus protein which belongs to the protein kinase superfamily and CAMK Ser/Thr protein kinase family and Tribbles subfamily. Highest expression Of TRIB3 is in liver, pancreas, peripheral blood leukocytes and bone marrow. It is also highly expressed in a number of primary lung, colon and breast tumors. TRIB3 is expressed in spleen, thymus, and prostate and is undetectable in other examined tissues, including testis, ovary, small intestine, colon, leukocyte, heart, brain, placenta, lung, skeletal muscle, and kidney. TRIB3 disrupts insulin signaling by binding directly to Akt kinases and blocking their activation. TRIB3 may bind directly to and mask the 'Thr-308' phosphorylation site in AKT1. It binds to ATF4 and inhibits its transcriptional activation activity. TRIB3 interacts with the NF-kappa-B transactivator p65 RELA and inhibits its phosphorylation and thus its transcriptional activation activity. It interacts with MAPK kinases and regulates activation of MAP kinases. It may play a role in programmed neuronal cell death but does not appear to affect non-neuronal cells. TRIB3 does not display kinase activity.

References
  • Wu M. et al., 2003, J. Biol. Chem. 278: 27072-9.
  • Kiss-Toth E. et al., 2004, J. Biol. Chem. 279: 42703-8.
  • Ord D., et al.,2005, Biochem. Biophys. Res. Commun. 330: 210-8.
  • Schwarzer R. et al., 2006, Cell. Signal. 18:899-909.
  • Greenman C. et al., 2007, Nature. 446:153-8.
  • Size / Price
    Catalog: MG50888-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"