Quick Order

Text Size:AAA

Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PBKcDNA Clone Product Information
cDNA Size:993
cDNA Description:ORF Clone of Mus musculus PDZ binding kinase DNA.
Gene Synonym:TOPK, AW538537, D14Ertd732e, 2810434B10Rik, Pbk
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedMG50887-ACG$325
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagMG50887-ACR$325
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedMG50887-ANG$325
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagMG50887-ANR$325
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedMG50887-CF$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedMG50887-CH$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedMG50887-CM$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedMG50887-CY$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone)MG50887-G$125
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedMG50887-NF$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedMG50887-NH$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedMG50887-NM$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedMG50887-NY$295
Mouse PDK / PDZ binding kinase / TOPK Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedMG50887-UT$295
 Learn more about expression Vectors
Related Products
Product nameProduct name

PDZ binding kinase (PBK), also known as TOPK (T-LAK cell-originated protein kinase), is a serine/threonine kinase related to the dual specific mitogen-activated protein kinase kinase (MAPKK) family, and has all the characteristic protein kinase subdomains and a C-terminal PDZ-binding T/SXV motif. PBK is expressed in the testis restrictedly expressed in outer cell layer of seminiferous tubules, as well as placenta. PBK may be enrolled in the activation of lymphoid cells and support testicular functions, with a suggested role in the process of spermatogenesis.This mitotic kinase phosphorylates MAP kinase p38 and seems to be active in mitosis. When phosphorylated, PBK forms a protein-protein interaction with tumor suppressor p53 (TP53), leading to TP53 destabilization and attenuation of G2/M checkpoint during doxorubicin-induced DNA damage. The expression level of PBK is thus upregulated in a variety of neoplasms including hematological malignancies.

Size / Price
List Price: $295.00  (Save $0.00)
Price:$295.00      [How to order]
Availability2-3 weeks
    Recently Viewed Items