Quick Order

Mouse APLP1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
APLP1cDNA Clone Product Information
cDNA Size:1965
cDNA Description:ORF Clone of Mus musculus amyloid beta (A4) precursor-like protein 1 DNA.
Gene Synonym:Aplp1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

APLP1, also known as amyloid-like protein 1, is a member of the highly conserved amyloid precursor protein gene family. APLP1 is a membrane-associated glycoprotein that is cleaved by secretases in a manner similar to amyloid beta A4 precursor protein cleavage. APLP1, together with APLP2, are important modulators of glucose. APLP1 may also play a role in synaptic maturation during cortical development. Alternatively spliced transcript variants encoding different isoforms have been described. APLP1 also is a mammalian homologue of amyloid precursor protein (APP). APP is a type I membrane protein that is genetically linked to Alzheimer's disease.

  • Wasco W. et al., 1993, Genomics. 15 (1): 237-9.
  • Needham BE. et al., 2008, J Pathol. 215 (2): 155-63.
  • Bayer TA. et al., 2000, Mol Psychiatry. 4 (6): 524-8.
  • Lee S. et al., 2011, Biochemistry. 50 (24): 5453-64.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items