Quick Order

Rabbit GAPDH Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GAPDHcDNA Clone Product Information
Gene_bank_ref_id:NM_001082253.1
cDNA Size:1002
cDNA Description:ORF Clone of Rabbit glyceraldehyde-3-phosphate dehydrogenase DNA.
Gene Synonym:GAPDH
Species:Rabbit
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Glyceraldehyde 3-phosphate dehydrogenase (GAPDH or G3PDH) is an enzyme of about 37kDa that is consisdered as a cellular enzyme involved in glycolysis. It catelyzes the sixth step of glycolysis. Glyceraldehyde-3-phosphate dehydrogenase (GAPDH) is a pleiotropic enzyme that is overexpressed in apoptosis and in several human chronic pathologies. Its role as a mediator for cell death has also been highlighted. A recent report suggests that GAPDH may be genetically associated with late-onset of Alzheimer's disease. Besides, deprenyl, which has originally been used as a monoamine oxidase inhibitor for Parkinson's disease, binds to GAPDH and displays neuroprotective actions.

References
  • Hara MR, et al. (2006) Neuroprotection by pharmacologic blockade of the GAPDH death cascade. PNA. 103 (10): 3887-9.
  • Hara MR, et al. (2006) GAPDH as a sensor of NO stress.Biochimica et Biophysica Acta (BBA) - Molecular Basis of Disease. 1762 (5): 502-9.
  • Tarze A, et al. (2007) GAPDH, a novel regulator of the pro-apoptotic mitochondrial membrane permeabilizationGAPDH and apoptosis. Oncogene. 26: 2606-20.
  • Yi MK, et al. (2000) Functional Significance of the Interaction of Hepatitis A Virus RNA with Glyceraldehyde 3-Phosphate Dehydrogenase (GAPDH): Opposing Effects of GAPDH and Polypyrimidine Tract Binding Protein on Internal Ribosome Entry Site Function. Journal of Virology. 74 (14) : 6459-68.
  • Size / Price
    Catalog:TG65041-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"