Quick Order

Rabbit CKMT1A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CKMT1AcDNA Clone Product Information
Gene_bank_ref_id:NM_001171313.1
cDNA Size:1254
cDNA Description:ORF Clone of Rabbit creatine kinase, mitochondrial 1A DNA.
Gene Synonym:CKMT1A
Species:Rabbit
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
 
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Rabbit CKMT1A Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Related Products
Product nameProduct name
Background

CKMT1A belongs to the ATP:guanido phosphotransferase family. It contains 1 phosphagen kinase C-terminal domain and 1 phosphagen kinase N-terminal domain. CKMT1A gene is one of two genes which encode the ubiquitous mitochondrial creatine kinase (CKMT1). CKMT1 is responsible for the transfer of high energy phosphate from mitochondria to the cytosolic carrier, creatine. It belongs to the creatine kinase isoenzyme family. It exists as two isoenzymes, sarcomeric MtCK (CKMT2) and ubiquitous MtCK, encoded by separate genes. CKMT1 occurs in two different oligomeric forms: dimers and octamers, in contrast to the exclusively dimeric cytosolic creatine kinase isoenzymes. Ubiquitous mitochondrial creatine kinase has 80% homology with the coding exons of sarcomeric CKMT1.

References
  • Haas RC, et al. (1989) Isolation and characterization of the gene and cDNA encoding human mitochondrial creatine kinase. J Biol Chem. 264(5):2890-7.
  • Stachowiak O, et al. (1998) Oligomeric state and membrane binding behaviour of creatine kinase isoenzymes: implications for cellular function and mitochondrial structure. Mol Cell Biochem. 184(1-2):141-51.
  • Lipskaya TY. (2001) Mitochondrial creatine kinase: properties and function. Biochemistry Mosc. 66(10):1098-111.
  • Size / Price
    Catalog:TG65032-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"