Quick Order

Mouse CIB2 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CIB2 cDNA Clone Product Information
Gene_bank_ref_id:BC005739.1
RefSeq ORF Size:564bp
cDNA Description:Full length Clone DNA of Mus musculus calcium and integrin binding family member 2 with C terminal His tag.
Gene Synonym:AI449053, 2810434I23Rik
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
References
  • Blazejczyk M, et al. (2006) Myristoylation and membranous localization of Calmyrin2, a new member of Neuronal Calcium-Sensor proteins. FENS Forum Abstracts. 3.
  • Hollenbach AD, et al. (2006) The EF-hand calcium-binding protein calmyrin inhibits the transcriptional and DNA-binding activity of Pax3. Biochimica et Biophysica Acta (BBA) - Gene Structure and Expression. 1574(3): 321-8.
  • Blazejczyk M, et al. (2009) Biochemical characterization and expression analysis of a novel EF-hand Ca2+ binding protein calmyrin2 (Cib2) in brain indicates its function in NMDA receptor mediated Ca2+ signaling. Archives of Biochemistry and Biophysics. 487(1): 66-78.
  • Size / Price
    Catalog: MG52594-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"