Quick Order

Mouse THOP1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse THOP1 cDNA Clone Product Information
Gene_bank_ref_id:NM_022653.4
RefSeq ORF Size:2064bp
cDNA Description:Full length Clone DNA of Mus musculus thimet oligopeptidase 1 with C terminal HA tag.
Gene Synonym:EP24.15, AI131655, AI327041, Thop1
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

THOP1, also known as Thimet oligopeptidase 1, Thimet oligopeptidase, EC 3.4.24.15, or EP24.15, is a zinc(II) endopeptidase implicated in the processing of numerous physiological peptides. As an intracellular enzyme, highly expressed in the brain, kidneys and neuroendocrine tissue, THOP1 has been proposed to metabolize peptides within cells, thereby affecting antigen presentation and G protein-coupled receptor signal transduction. Its substrates is gonadotrophin-releasing hormone (GnRH), an important hypothalamic hormone that regulates the synthesis and release of oestradiol and facilitates female sexual behaviour. THOP1 against toxic effects of Abeta in the early stages of Alzheimer disease (AD) pathology, and suggest that the observed increase in THOP1 expression might be part of a compensatory defense mechanism of the brain against an increased Abeta load.

References
  • Cyr NE, et al. (2010) Nuclear Thimet oligopeptidase is coexpressed with oestrogen receptor alpha in hypothalamic cells and regulated by oestradiol in female mice. J Neuroendocrinol. 22(8): 936-43.
  • Berti DA, et al. (2009) Analysis of intracellular substrates and products of thimet oligopeptidase in human embryonic kidney 293 cells. J Biol Chem. 284(21): 14105-16.
  • Russo LC, et al. (2009) Interaction with calmodulin is important for the secretion of thimet oligopeptidase following stimulation. FEBS J. 276(16): 4358-71.
  • Pollio G, et al. (2008) Increased expression of the oligopeptidase THOP1 is a neuroprotective response to Abeta toxicity. Neurobiol Dis. 31(1): 145-58.
  • Bruce LA, et al. (2008) Hydrogen bond residue positioning in the 599-611 loop of thimet oligopeptidase is required for substrate selection. FEBS J. 275(22): 5607-17.
  • Size / Price
    Catalog: MG50828-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"