After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse APEX1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
APEX1cDNA Clone Product Information
cDNA Size:954
cDNA Description:ORF Clone of Mus musculus apurinic/apyrimidinic endonuclease 1 DNA.
Gene Synonym:APE, Apex, HAP1, Ref-1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-His Vector Information
Vector Name pCMV3-N-His
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-His Physical Map

Schematic of pCMV3-N-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

The enzyme is known to be a redox factor (Ref-1) stimulating DNA binding activity of AP-1 binding proteins such as Fos and Jun as well as a multifunctional DNA repair enzyme having 5' AP endonuclease, DNA 3' repair diesterase, 3'-5' exonuclease and DNA 3'-phosphatase activities.Although Apex mRNA was expressed ubiquitously, the levels varied significantly, suggesting organ- or tissue-specific expression of the Apex gene. The highest level was observed in the testis, relatively high levels in the thymus, spleen, kidney and brain, and the lowest level in the liver in rats. However, the present results suggested that APEX/Ref-1 gene product can interact with AP-1 binding proteins in brain, especially in the hippocampal formation, to regulate some brain functions by redox-activation.

  • Ono Y, et al. (1995) Developmental expression of APEX nuclease, a multifunctional DNA repair enzyme, in mouse brains. Brain Res Dev Brain Res.86 (1-2): 1-6.
  • Tan Y, et al. (1996) cDNA cloning of rat major AP endonuclease (APEX nuclease) and analyses of its mRNA expression in rat tissues. Acta Med Okayama. 50 (1): 53-60.
  • Yao M, et al. (1999) Genomic structure of the rat major AP endonuclease gene (Apex) with an adjacent putative O-sialoglycoprotease gene (Prsmg1/Gcpl1) and a processed Apex pseudogene (Apexp1). Acta Med Okayama. 53 (6): 245-52.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items