Quick Order

Text Size:AAA

Mouse CD160 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD160cDNA Clone Product Information
cDNA Size:558
cDNA Description:ORF Clone of Mus musculus CD160 antigen DNA.
Gene Synonym:By55, AU045688, Cd160
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

CD160 antigen, also known as Natural killer cell receptor BY55 and CD160, is a cell membrane protein which contains one Ig-like V-type (immunoglobulin-like) domain. CD160 is a GPI-anchored lymphocyte surface receptor in which expression is mostly restricted to the highly cytotoxic CD56(dim)CD16(+) peripheral blood NK subset. CD160 is a receptor showing broad specificity for both classical and non-classical MHC class I molecules. CD160 is expressed in spleen, peripheral blood, and small intestine. Expression of CD160 is restricted to functional NK and T cytotoxic lymphocytes. CD160 acts as a co-activator receptor for CD3-induced proliferation of CD4+ CD160+ T cells isolated from inflammatory skin lesions. Unique CD4+ CD160+ lymphocyte subset may play a role in the pathogenesis of skin inflammation. Activated NK lymphocytes release a soluble form of CD160 that functionally impairs the MHC-I-specific cytotoxic CD8(+) T lymphocyte responsiveness.

  • Barakonyi A. et al., 2004, J Immunol.173 (9): 5349-54.
  • Rabot M. et al., 2006, Transpl Immunol. 17 (1): 36-8.
  • Abecassis S. et al., 2007, J Invest Dermatol. 127?(5): 1161-6.
  • Giustiniani J.?et al., 2007, J Immunol. 178 (3): 1293-300.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items