Quick Order

Text Size:AAA

Mouse SOD1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SOD1cDNA Clone Product Information
Gene_bank_ref_id:NM_011434.1
cDNA Size:465
cDNA Description:ORF Clone of Mus musculus superoxide dismutase 1, soluble DNA.
Gene Synonym:Ipo1, SODC, Ipo-1, Sod-1, CuZnSOD, Cu/Zn-SOD, B430204E11Rik
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

SOD1 belongs to the Cu-Zn superoxide dismutase family. It binds copper and zinc ions and is one of two isozymes responsible for destroying free superoxide radicals in the body. The encoded isozyme is a soluble cytoplasmic protein, acting as a homodimer to convert naturally-occuring but harmful superoxide radicals to molecular oxygen and hydrogen peroxide. The other isozyme is a mitochondrial protein. Mutations in this gene have been implicated as causes of familial amyotrophic lateral sclerosis. Rare transcript variants have been reported for this gene. SOD1 destroys radicals which are normally produced within the cells and which are toxic to biological systems. Defects in SOD1 are the cause of amyotrophic lateral sclerosis type 1 (ALS1). ALS1 is a familial form of amyotrophic lateral sclerosis, a neurodegenerative disorder affecting upper and lower motor neurons and resulting in fatal paralysis. Sensory abnormalities are absent. Death usually occurs within 2 to 5 years. The etiology of amyotrophic lateral sclerosis is likely to be multifactorial, involving both genetic and environmental factors. The disease is inherited in 5-10% of cases leading to familial forms.

References
  • Murakami K, et al. (2011) SOD1 (copper/zinc superoxide dismutase) deficiency drives amyloid β protein oligomerization and memory loss in mouse model of Alzheimer disease. J Biol Chem. 286(52):44557-68.
  • Thompson M, et al. (2012) Paradoxical roles of serine racemase and D-serine in the G93A mSOD1 mouse model of amyotrophic lateral sclerosis. J Neurochem. 120(4):598-610.
  • Magrané J, et al. (2012) Mitochondrial dynamics and bioenergetic dysfunction is associated with synaptic alterations in mutant SOD1 motor neurons. J Neurosci. 32(1):229-42.
  • Gertz B, et al. (2012) Nuclear localization of human SOD1 and mutant SOD1-specific disruption of survival motor neuron protein complex in transgenic amyotrophic lateral sclerosis mice. J Neuropathol Exp Neurol. 71(2):162-77.
  • Size / Price
    Catalog:MG52544-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"