After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FZD10 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FZD10 cDNA Clone Product Information
Gene_bank_ref_id:NM_007197.3
RefSeq ORF Size:1746bp
cDNA Description:Full length Clone DNA of Homo sapiens frizzled family receptor 10 with N terminal HA tag.
Gene Synonym:Fz10, FzE7, CD350, FZ-10, hFz10
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

Mouse Frizzled-10, also known as Fz-10, CD350 and FZD10, is a multi-pass membrane protein which belongs to the G-protein coupled receptor Fz/Smo family. Frizzled-10 / FZD10 is abundantly expressed in the cerebellum, followed by cerebral cortex, medulla and spinal cord; very low levels in total brain, frontal lobe, temporal lobe and putamen. It is weakly expressed in adult brain, heart, lung, skeletal muscle, pancreas, spleen and prostate. Frizzled-10 / FZD10 is a receptor for Wnt proteins. Most of frizzled receptors are coupled to the beta-catenin canonical signaling pathway, which leads to the activation of disheveled proteins, inhibition of GSK-3 kinase, nuclear accumulation of beta-catenin and activation of Wnt target genes. A second signaling pathway involving PKC and calcium fluxes has been seen for some family members, it is not yet clear if it represents a distinct pathway or if it can be integrated in the canonical pathway, as PKC seems to be required for Wnt-mediated inactivation of GSK-3 kinase. Both pathways seem to involve interactions with G-proteins. Frizzled-10 / FZD10 may also be involved in transduction and intercellular transmission of polarity information during tissue morphogenesis and/or in differentiated tissues.

Size / Price
Catalog: HG16045-NY
List Price:   (Save )
Price:      [How to order]
Availability2-3 weeksShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"