After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse PFN2 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse PFN2 cDNA Clone Product Information
Gene_bank_ref_id:NM_019410.3
RefSeq ORF Size:423bp
cDNA Description:Full length Clone DNA of Mus musculus profilin 2 with N terminal His tag.
Gene Synonym:Pfn
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
Background

Profilin 2, also known as PFN2, is a ubiquitous actin monomer-binding protein belonging to the profilin family. It is highly expressed in brain, skeletal muscle and kidney and less strongly in heart, placenta, lung and liver. Profilin 2 binds to actin and affects the structure of the cytoskeleton. At high concentrations, profilin prevents the polymerization of actin, whereas it enhances it at low concentrations. Profilin 2 is thought to regulate actin polymerization in response to extracellular signals. It inhibits the formation of IP3 and DG by binding to PIP2.

References
  • Da Silva. et al., 2003, J Cell Biol. 162 (7): 1267-79.
  • Honore B. et al., 1993, FEBS Lett. 330 (2): 151-5.
  • Joensuu T. et al., 1997, Genomics. 38 (3): 255-63.
  • Size / Price
    Catalog: MG51608-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"