After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CD52 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CD52 cDNA Clone Product Information
Gene_bank_ref_id:NM_013706.2
RefSeq ORF Size:225bp
cDNA Description:Full length Clone DNA of Mus musculus CD52 antigen with C terminal HA tag.
Gene Synonym:B7, MB7, CLS1, B7-Ag, AI463198, CAMPATH-1, Cd52
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

CD52 / CDW52 is a small glycosylphosphatidylinositol (GPI) anchored glycoprotein. It has a mature peptide comprising only 12 amino acids and is abundantly expressed on human lymphocytes. From the clinical point of view this protein is an important target for therapeutic interventions aimed at leukocyte depletion in hematological malignancies and post-transplant immunosuppression. CD52 / CDW52 may play a role in carrying and orienting carbohydrate. It is an unusually good target for complement-mediated cell lysis.

References
  • Piccaluga PP, et al. (2007) Expression of CD52 in peripheral T-cell lymphoma. Haematologica. 92(4): 566-7.
  • Size / Price
    Catalog: MG50721-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"