Quick Order

Text Size:AAA

Mouse WFDC2 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse WFDC2 cDNA Clone Product Information
Gene_bank_ref_id:NM_026323.2
RefSeq ORF Size:525bp
cDNA Description:Full length Clone DNA of Mus musculus WAP four-disulfide core domain 2 with C terminal HA tag.
Gene Synonym:HE4, WAP5, 1600023A02Rik, Wfdc2
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

WAP four-disulfide core domain protein 2, also known as Epididymal secretory protein E4, Major epididymis-specific protein E4, Putative protease inhibitor WAP5, WFDC2 and HE4, is a secreted protein which contains two WAP domains. WFDC2 / HE4 is a member of a family of stable 4-disulfide core proteins that are secreted at high levels. It is expressed in a number of normal tissues, including male reproductive system, regions of the respiratory tract and nasopharynx. It is highly expressed in a number of tumors cells lines, such ovarian, colon, breast, lung and renal cells lines. Initially described as being exclusively transcribed in the epididymis. WFDC2 may be a component of the innate immune defences of the lung, nasal and oral cavities and suggest that WFDC2 functions in concert with related WAP domain containing proteins in epithelial host defence. WFDC2 re-expression in lung carcinomas may prove to be associated with tumour type and should be studied in further detail. Mammary gland expression of tammar WFDC2 during the course of lactation showed WFDC2 was elevated during pregnancy, reduced in early lactation and absent in mid-late lactation. WFDC2 / HE4 can undergo a complex series of alternative splicing events that can potentially yield five distinct WAP domain containing protein isoforms.

References
  • Bingle,L. et al., 2002, Oncogene. 21 (17):2768-73.
  • Hellström,I. et al., 2003, Cancer Res. 63 (13):3695-700.
  • Bingle,L. et al., 2006, Respir Res. 7 : 61.
  • Galgano,M.T. et al., 2006, Mod Pathol.19 (6):847-53.
  • Sharp,J.A. et al., 2007, Evol Dev. 9 (4): 378-92.
  • Size / Price
    Catalog: MG50715-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"