After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse UCHL3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
UCHL3cDNA Clone Product Information
cDNA Size:693
cDNA Description:ORF Clone of Mus musculus ubiquitin carboxyl-terminal esterase L3 (ubiquitin thiolesterase) DNA.
Gene Synonym:Uchl3
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Ubiquitin carboxyl-terminal hydrolase isozyme L3, also known as UCH-L3, Ubiquitin thioesterase L3 and UCHL3, is a ubiquitin-protein hydrolase which belongs to the peptidase C12 family. It is involved both in the processing of ubiquitin precursors and of ubiquitinated proteins. This enzyme is a thiol protease that recognizes and hydrolyzes a peptide bond at the C-terminal glycine of either ubiquitin or NEDD8. UCHL3 is highly expressed in heart, skeletal muscle, and testis. UCHL1 and UCHL3 are two of the deubiquitinating enzymes expressed in the brain. These phenotypes indicate the importance of UCHL1 and UCHL3 in the regulation of the central nervous system. UCHL3 functions as a de-ubiquitinating enzyme where lack of its hydrolase activity may result in the prominent accumulation of ubiquitinated proteins and subsequent induction of stress responses in skeletal muscle. UCHL3 has also been identified as a tumor-specific antigen in colon cancer.

  • Wood,M.A. et al., 2005, Hippocampus  15 (5):610-21.
  • Kwon,J. et al., 2006, Exp Anim  55 (1):35-43.
  • Setsuie,R. et al., 2009, Neurochem Int  54 (5-6):314-21.
  • Setsuie,R. et al., 2010, Neurochem Int  56 (8):911-8.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items