Quick Order

Mouse YWHAE ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse YWHAE cDNA Clone Product Information
Gene_bank_ref_id:NM_009536.4
RefSeq ORF Size:768bp
cDNA Description:Full length Clone DNA of Mus musculus tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, epsilon polypeptide with C terminal HA tag.
Gene Synonym:AU019196, Ywhae
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

YWHAE, also known as 14-3-3 epsilon, mediate signal transduction by binding to phosphoserine-containing proteins. 14-3-3 epsilon / YWHAE is a member of the 14-3-3 proteins family. 14-3-3 proteins are a group of highly conserved proteins that are involved in many vital cellular processes such as metabolism, protein trafficking, signal transduction, apoptosis and cell cycle regulation. 14-3-3 proteins are mainly localized in the synapses and neuronal cytoplasm, and seven isoforms have been identified in mammals. This family of proteins was initially identified as adaptor proteins which bind to phosphoserine-containing motifs. Binding motifs and potential functions of 14-3-3 proteins are now recognized to have a wide range of functional relevance. 14-3-3 epsilon / YWHAE is found in both plants and mammals, and this protein is 100% identical to the mouse ortholog. YWHAE interacts with CDC25 phosphatases, RAF1 and IRS1 proteins, suggesting its role in diverse biochemical activities related to signal transduction, such as cell division and regulation of insulin sensitivity. It has also been implicated in the pathogenesis of small cell lung cancer. 14-3-3 epsilon / YWHAE is implicated in the regulation of a large spectrum of both general and specialized signaling pathways. 14-3-3 epsilon / YWHAE Binds to a large number of partners, usually by recognition of a phosphoserine or phosphothreonine motif. This Binding generally results in the modulation of the activity of the binding partner.

References
  • Ikeda M, et al. (2008) Identification of YWHAE, a gene encoding 14-3-3epsilon, as a possible susceptibility gene for schizophrenia. Hum Mol Genet. 17(20): 3212-22.
  • Mignon-Ravix C, et al. (2010) Deletion of YWHAE in a patient with periventricular heterotopias and pronounced corpus callosum hypoplasia. J Med Genet. 47(2): 132-6.
  • Nagamani SC, et al. (2009) Microdeletions including YWHAE in the Miller-Dieker syndrome region on chromosome 17p13.3 result in facial dysmorphisms, growth restriction, and cognitive impairment. J Med Genet. 46(12): 825-33.
  • Size / Price
    Catalog: MG50691-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"