After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CD300A Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD300AcDNA Clone Product Information
cDNA Size:957
cDNA Description:ORF Clone of Mus musculus CD300A antigen DNA.
Gene Synonym:Clm8, LMIR1, MMAC8, Pigr4, MAIR-I, mcpir1, MAIR-Ia, B230315M08Rik, Cd300a
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Mouse CMRF35-like molecule 8, also known as CD300 antigen-like family member A, CMRF35-H9, Immunoglobulin superfamily member 12, Inhibitory receptor protein 60, NK inhibitory receptor, CD300a and CMRF35H, is a single-pass type I membrane protein which belongs to the CD300 family. The CD300 family of myeloid immunoglobulin receptors includes activating ( CD300b, CD300e ) and inhibitory members ( CD300a, CD300f ), as well as molecules presenting a negative charge within their transmembrane domain ( CD300c, CD300d ).  CD300A / IGSF12 is expressed not only by natural killer (NK) cells but also by T-cell subsets, B-cells, dendritic cells, mast cells, granulocytes and monocytes.It contains one Ig-like V-type ( immunoglobulin-like ) domain. CD300A / IGSF12 is an inhibitory receptor which may contribute to the down-regulation of cytolytic activity in natural killer (NK) cells, and to the down-regulation of mast cell degranulation. CD300c is a functional immune receptor able to deliver activating signals upon ligation in RBL-2H3 mast cells. CD300c signaling is partially mediated by a direct association with the immune receptor tyrosine-based activation motif-bearing adaptor FcεRγ. CD300a and CD300c play an important role in the cross-regulation of TNF-alpha and IFN-alpha secretion from plasmacytoid dendritic cells (pDCs).

  • Bachelet,I. et al., 2005, J. Immunol. 175:7989-7995.
  • Bachelet,I. et al., 2008, J Immunol. 180 (9):6064-9.
  • Ju,X. et al., 2008, Blood. 112 (4):1184-94.
  • Martínez-Barriocanal,A. et al., 2010, J Biol Chem. 285 (53):41781-94.
  • Lankry,D. et al., 2010, J Immunol. 185 (5):2877-86.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items