After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse ENPP2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
ENPP2cDNA Clone Product Information
cDNA Size:2589
cDNA Description:ORF Clone of Mus musculus ectonucleotide pyrophosphatase/phosphodiesterase 2, transcript variant 2 DNA.
Gene Synonym:ATX, Npps2, Pdnp2, PD-Ialpha, Enpp2
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse ENPP2 transcript variant 2 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Related Products
Product nameProduct name

ENPP2 (Ectonucleotide pyrophosphatase/phosphodiesterase family member 2), also referred as Autotaxin, is a secreted enzyme encoded by the ENPP2 gene. This gene product stimulates the motility of tumor cells, has angiogenic properties, and its expression is upregulated in several kinds of carcinomas. The Autotaxin protein is important for generating the lipid signaling molecule lysophosphatidic acid (LPA), which is a potent mitogen, which facilitates cell proliferation and migration, neurite retraction, platelet aggregation, smooth muscle contraction, actin stress formation and cytokine and chemokine secretion. ATX has been found to catalyze the formation of cyclic phosphatidic acid (cPA), which have antitumor role by antimitogenic regulation of cell cycle, inhibition of cancer invasion and metastasis. LPA receptors and ATX are upregulated in numerous cancer cell types and show expression patterns that correlate with tumor cell invasiveness. Thus, Autotaxin has recently emerged as an attractive target for the development of anti-cancer chemotherapeutics. In addition, Serum ATX activity was found to be enhanced in relation to hepatic fibrosis in chronic liver disease due to hepatitis virus C infection.

  • Tania M, et al. (2010) Autotaxin: a protein with two faces. Biochem Biophys Res Commun. 401(4): 493-7.
  • Ikeda H, et al. (2009) Significance of serum autotaxin activity in gastrointestinal disease. Rinsho Byori. 57(5): 445-9.
  • Parrill AL, et al. (2008) Autotaxin inhibition: challenges and progress toward novel anti-cancer agents. Anticancer Agents Med Chem. 8(8): 917-23.
  • Pradere J.P, et al. (2007) Secretion and lysophospholipase D activity of autotaxin by adipocytes are controlled by N-glycosylation and signal peptidase. Biochim Biophys Acta. 1771: 93-102.
  • Boucher J, et al. (2005) Potential involvement of adipocyte insulin resistance in obesity-associated up-regulation of adipocyte lysophospholipase D/autotaxin expression. Diabetologia. 48: 569-77.