After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse GSK3B Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GSK3BcDNA Clone Product Information
cDNA Size:1263
cDNA Description:ORF Clone of Mus musculus glycogen synthase kinase 3 beta DNA.
Gene Synonym:GSK3, GSK-3, C86142, GSK-3beta, 7330414F15Rik, 8430431H08Rik, Gsk3b
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Mouse GSK3B Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged on other vectors
Related Products
Product nameProduct name

GSK3B is a serine-threonine kinase, belonging to the glycogen synthase kinase subfamily. It Contains 1 protein kinase domain, and is expressed in testis, thymus, prostate and ovary and weakly expressed in lung, brain and kidney. GSK3B is involved in energy metabolism, neuronal cell development, and body pattern formation. Polymorphisms in GSK3B gene have been implicated in modifying risk of Parkinson disease, and studies in mice show that overexpression of this gene may be relevant to the pathogenesis of Alzheimer disease. GSK3B participates in the Wnt signaling pathway. It is implicated in the hormonal control of several regulatory proteins including glycogen synthase, MYB and the transcription factor JUN. Phosphorylates JUN at sites proximal to its DNA-binding domain, thereby reducing its affinity for DNA. Phosphorylates MUC1 in breast cancer cells, and decreases the interaction of MUC1 with CTNNB1/beta-catenin. GSK3B also plays an important role in ERBB2-dependent stabilization of microtubules at the cell cortex. It prevents the phosphorylation of APC and CLASP2, allowing its association with the cell membrane. In turn, membrane-bound APC allows the localization of MACF1 to the cell membrane, which is required for microtubule capture and stabilization. GSK3B phosphorylates MACF1 and this phosphorylation inhibits the binding of MACF1 to microtubules which is critical for its role in bulge stem cell migration and skin wound repair. It may be required for early embryo development and neuron differentiation.

  • Bergmann C, et al. (2011) Inhibition of glycogen synthase kinase 3β induces dermal fibrosis by activation of the canonical Wnt pathway. Ann Rheum Dis. 70(12):2191-8.
  • Ban JO, et al. (2011) Troglitazone, a PPAR agonist, inhibits human prostate cancer cell growth through inactivation of NFκB via suppression of GSK-3β expression. Cancer Biol Ther. 12(4):288-96.
  • Tsukigi M, et al. (2012) Re-expression of miR-199a suppresses renal cancer cell proliferation and survival by targeting GSK-3β. Cancer Lett. 315(2):189-97.
  • Nandan D, et al. (2012) Myeloid cell IL-10 production in response to leishmania involves inactivation of glycogen synthase kinase-3β downstream of phosphatidylinositol-3 kinase. J Immunol. 188(1):367-78.