After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse RAMP3 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
RAMP3cDNA Clone Product Information
cDNA Size:444
cDNA Description:ORF Clone of Mus musculus receptor (calcitonin) activity modifying protein 3 DNA.
Gene Synonym:AI850306
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-His (suitable for secretary and membane protein expession) Vector Information
Vector Name pCMV3-SP-N-His
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-SP-N-His (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-His (suitable for secretary and membane protein expession) Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

RAMP3 belongs to the RAMP family. Members of this family are single-transmembrane-domain proteins, called receptor (calcitonin) activity modifying proteins (RAMPs). RAMPs have a wide biological distribution; high concentrations are found in the brain, lung, liver, heart and spleen with lower expression levels present in the testes, gastrointestinal tract and thyroid. RAMPs are type I transmembrane proteins with an extracellular N terminus and a cytoplasmic C terminus. They are required to transport calcitonin-receptor-like receptor (CRLR) to the plasma membrane. CRLR, a receptor with seven transmembrane domains, can function as either a calcitonin gene-related peptide (CGRP) receptor or an adrenomedullin receptor, depending on which members of the RAMP family are expressed. In the presence of RAMP3 protein, CRLR functions as an adrenomedullin receptor.

  • Stelzl U, et al. (2005) A human protein-protein interaction network: a resource for annotating the proteome. Cell. 122(6):957-68.
  • Scherer SW, et al. (2003) Human chromosome 7: DNA sequence and biology. Science. 300(5620):767-72.
  • Kuwasako K, et al. (2004) Characterization of the human calcitonin gene-related peptide receptor subtypes associated with receptor activity-modifying proteins. Mol Pharmacol. 65(1):207-13.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items