Quick Order

Text Size:AAA

Mouse CD200R4 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD200R4cDNA Clone Product Information
cDNA Size:813
cDNA Description:ORF Clone of Mus musculus CD200 receptor 4 DNA.
Gene Synonym:MCD200RLa, F630107N04Rik, Cd200r4
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Mouse Cell surface glycoprotein CD200 receptor 4, also known as Cell surface glycoprotein OX2 receptor 4, CD200 cell surface glycoprotein receptor-like 4, CD200RLa, and CD200R4, is a single-pass type I  membrane protein which belongs to the CD200R family. CD200 (OX2) is a cell surface glycoprotein that interacts with a structurally related receptor (CD200R) expressed mainly on myeloid cells and is involved in regulation of macrophage and mast cell function. In mouse there are up to five genes related to CD200R with conflicting data as to whether they bind CD200. CD200R4 contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. CD200R4 is highly expressed in monocytes, NK cells and a subset of NKT cells. It is weakly expressed in granulocytes and B cells (at protein level). CD200R4 is also expressed in brain, lung, testis, thymus, intestine and uterus. and in bone marrow derived-macrophage and dendritic cells and mast cells. CD200R4 is involved in the recruitment or surface expression of the TYROBP receptor.

  • Wright, GJ. et al.,2003, J. Immunol. 171: 3034-46.
  • Gorczynski, R. et al., 2004,J. Immunol. 172:7744-7749.
  • Gorczynski, RM. et al.,2004, Am. J. Reprod. Immunol. 52:147-163.
  • Hatherley, D. et al.,2005. J. Immunol. 175: 2469-2474.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items