After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!
Text Size:AAA

Mouse MET ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MET cDNA Clone Product Information
Gene_bank_ref_id:NM_008591.2
RefSeq ORF Size:4140bp
cDNA Description:Full length Clone DNA of Mus musculus met proto-oncogene with C terminal HA tag.
Gene Synonym:HGF, HGFR, Par4, c-Met, AI838057, Met
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Rat EphB3 / HEK2 / Eph Receptor B3 Protein (His Tag, ECD)Human VEGFR1 / FLT-1 Protein (Fc Tag)Human FGFR2 / CD332 Protein (ECD, His Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, Fc Tag)Human HER2 / ErbB2 ProteinHuman HER2 / ErbB2 Protein (ECD, domain IV) (His Tag)Canine TrkB / NTRK2 Protein (Fc Tag)Rhesus HER3 / ErbB3 ProteinCynomolgus / Rhesus FGFR3 / CD333 Protein (His Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), His Tag)Human FGFR2 / CD332 Protein (beta(IIIc), His Tag)Rhesus PDGFRB / CD140b Protein (Fc Tag)Human FGFR3 / CD333 Protein (alpha(IIIb), Fc Tag)Human HER3 / ErbB3 ProteinHuman FGFR2 / CD332 Protein (alpha(IIIb), Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (ECD, His Tag)Rabbit TrkA / NTRK1 Protein (His Tag)Cynomolgus HER2 / ErbB2 Protein (ECD, Fc Tag)Human EGFR / HER1 / ErbB1 (aa 668-1210) Protein (His & GST Tag)Mouse EphB6 Protein (His Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (Fc Tag)Cynomolgus / Rhesus c-MET / HGFR Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Cynomolgus / Rhesus c-MET / HGFR ProteinCynomolgus HER2 / ErbB2 Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human c-MET / HGFR Protein (His & Fc Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human HER2 / ErbB2 Protein (Fc Tag)Human TrkB / NTRK2 Protein (His Tag)Human DDR2 Kinase / CD167b Protein (Fc Tag)Human EphB2 Protein (His & Fc Tag)Human EphB4 / HTK Protein (Fc Tag)Human EphB4 / HTK Protein (His Tag)Human EphB4 / HTK ProteinHuman EphB6 / EphB6 Protein (Fc Tag)Human EphB6 / EphB6 ProteinHuman HER3 / ErbB3 Protein (Fc Tag)Human HER4 / ErbB4 Protein (His & Fc Tag)Human FGFR1 / CD331 Protein (His & Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human FGFR4 / FGF Receptor 4 Protein (His & Fc Tag)Human IGF1R / CD221 Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 ProteinHuman MERTK / Mer Protein (His & Fc Tag)Human MERTK / Mer ProteinHuman PDGFRa / CD140a Protein (Fc Tag)Human PDGFRa / CD140a ProteinHuman Tie2 / CD202b Protein (His & Fc Tag)Human TrkC / NTRK3 Protein (His & Fc Tag)Human TrkC / NTRK3 Protein (His Tag)Human VEGFR3 / FLT4 Protein (His Tag)Human FGFR2 Protein (His & Fc Tag)Mouse FGFR3 / CD333 Protein (His & Fc Tag)Mouse FGFR4 / CD334 Protein (His Tag)Human FGFR1 / CD331 Protein (His Tag)Mouse FGFR4 / CD334 Protein (His & Fc Tag)Mouse Axl Kinase Protein (His & Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (Fc Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Human Tie2 / CD202b / TEK Protein (His Tag)Human EphB2 Protein (His Tag)Human VEGFR3 / FLT4 Protein (Fc Tag)Human TrkA / NTRK1 Protein (His & Fc Tag)Human TrkA / NTRK1 Protein (His Tag)Human TrkB / NTRK2 Protein (His & Fc Tag)Human HER2 / ErbB2 Protein (His Tag)Human PDGFRa / CD140a Protein (His Tag)Human Insulin Receptor / INSR / CD220 Protein (long isoform, His Tag)Human Insulin Receptor / INSR / CD220 Protein (short isoform, His Tag)Human CD140b / PDGFRB Protein (His Tag)Mouse FGFR3 / CD333 Protein (His Tag)Mouse TrkC / NTRK3 Protein (His Tag)Human FGFR2 / CD332 Protein (His Tag)Human FLT-3 / CD135 / FLK-2 Protein (His Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Human c-MET / HGFR Protein (His Tag)Mouse EphA6 / EHK-2 Protein (His Tag)Mouse FGFRL1 / FGFR5 Protein (His Tag)Mouse Axl Kinase Protein (His Tag)Human HER3 / ErbB3 Protein (His Tag)Human EphB6 / EphB6 Protein (His Tag)Human EphA4 Protein (His Tag)Human EGFR / HER1 / ErbB1 Protein (His Tag)Human Axl Kinase Protein (His Tag)Human EphA7 / EHK3 Protein (His Tag)Mouse DDR2 Kinase / CD167b Protein (His Tag)Human TrkA / NTRK1 Protein (aa 285-413, His Tag)Human TrkA / NTRK1 Protein (aa 194-413, His Tag)Mouse EphA4 / HEK8 Protein (His Tag)Mouse EphA4 / HEK8 Protein (Fc Tag)Mouse FGFR1 / CD331 Protein (His Tag)Mouse FGFR1 / CD331 Protein (Fc Tag)Mouse EphB3 / HEK2 Protein (His Tag)Mouse EphB4 / HTK Protein (Fc Tag)Mouse EphB4 / HTK Protein (His Tag)Mouse EphA6 / EHK-2 Protein (Fc Tag)Mouse EphA7 / EHK-3 Protein (His Tag)Mouse c-kit / CD117 Protein (Fc Tag)Mouse c-kit / CD117 Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human MUSK Kinase Protein (aa 433-783, His & GST Tag)Mouse c-MET / HGFR Protein (Fc Tag)Mouse c-MET / HGFR Protein (His Tag)Human Tie1 Protein (His Tag)Human c-KIT / CD117 Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (His Tag)Mouse VEGFR3 / FLT-4 Protein (Fc Tag)Rat HER2 / ErbB2 ProteinRat HER2 / ErbB2 Protein (Fc Tag)Rat HER2 / ErbB2 Protein (His Tag)Rhesus HER2 / ErbB2 Protein (Fc Tag)Rhesus HER2 / ErbB2 Protein (His Tag)Mouse Tie2 / CD202b / TEK Protein (ECD, Fc Tag)Human EphB1 / EPHT2 Protein (His Tag)Human PDGFRB / CD140b Protein (His & Fc Tag)Human CD136 / MST1R Protein (His Tag)Human EphA4 Protein (His & Fc Tag)Canine c-MET / HGFR Protein (His Tag)Human VEGFR1 / FLT-1 Protein (His Tag)Human FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse EphB1 / EPHT2 Protein (His & GST Tag)Human RET Kinase Protein (aa 658-1114, His & GST Tag)Mouse EphB1 / EPHT2 Protein (His Tag)Mouse TrkB / NTRK2 Protein (His Tag)Human RET Kinase Protein (His Tag)Mouse MERTK / Mer Protein (Fc Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Mouse HER2 / ErbB2 / CD340 Protein (His Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Mouse HER3 / ErbB3 Protein (His Tag)Mouse HER2 / ErbB2 Protein (Fc Tag)Rhesus HER3 / ErbB3 Protein (His Tag)Rhesus HER3 / ErbB3 Protein (Fc Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag)Rat Tie2 / TEK Protein (Fc Tag)Human HER2 / ErbB2 Protein (ECD, domain I) (His Tag)Human MERTK / Mer Protein GST TagRat FGFR4 / FGF Receptor 4 Protein (Fc Tag)Human CSF1R / MCSF Receptor / CD115 Protein (His & GST Tag)Human FGFR1 / CD331 Protein (His & GST Tag)Human Insulin Receptor / INSR / CD220 Protein (His & GST Tag)Mouse EGFR / HER1 / ErbB1 Protein (Fc Tag)Mouse EGFR / HER1 / ErbB1 Protein (His Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human HER2 / ErbB2 / CD340 (676-1255) Protein (His & GST Tag)Human KIT / c-KIT / CD117 Protein (aa 540-972, His & GST Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (His Tag)Human CSF1R / MCSF Receptor / CD115 Protein (aa 543-922, His & GST Tag)Human / Rhesus HER4 / ErbB4 Protein (His Tag)Human / Rhesus HER4 / ErbB4 Protein (Fc Tag)Human HER3 / ErbB3 Protein (aa 730-1065, His & GST Tag)Human FGFR2 / CD332 Protein (aa 400-821, His & GST Tag)Human VEGFR2 / Flk-1 / CD309 / KDR Protein (His & GST Tag)Cynomolgus FGFR3 Protein (Fc Tag)Human Tie2 / CD202b / TEK Protein (His & GST Tag)Human EphA7 / EHK3 Protein (His & GST Tag)Mouse MERTK / Mer Protein (His & GST Tag)Mouse VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse Tie2 / TEK Protein (His Tag)Mouse Tie2 / TEK Protein (aa 770-1122, His & GST Tag)Mouse DDR1 Kinase / MCK10 / CD167 Protein (His & GST Tag)Rat TrkB / NTRK2 Protein (Fc Tag)Human DDR2 Kinase / CD167b Protein (aa 422-855, His & GST Tag)Human c-MET / HGFR Protein (aa 956-1390, His & GST Tag)Human DDR1 Kinase / MCK10 / CD167 Protein (aa 444-913, His & GST Tag)Human EphA4 / HEK8 Protein (aa 570-986, His & GST Tag)Rat EphA4 Protein (His Tag)Rhesus EphA4 Protein (Fc Tag)Rat EGFR / HER1 / ErbB1 Protein (His Tag)Human PDGFRa / CD140a Protein (His & GST Tag)Rat EphA4 Protein (Fc Tag)Human EphB4 / HTK Protein (aa 563-987, His & GST Tag)Human EphB2 / Hek5 Protein (aa 570-987, His & GST Tag)Mouse HER4 / ErbB4 Protein (His Tag)Rat HER3 / ErbB3 Protein (Fc Tag)Rat HER3 / ErbB3 Protein (His Tag)Rat KIT / c-KIT Protein (Fc Tag)Human EphB1 / EPHT2 Protein (aa 565-984, His & GST Tag)Human EphB3 / HEK2 Protein (aa 585-998, His & GST Tag)Rat DDR2 Kinase / CD167b Protein (Fc Tag)Rat KIT / c-KIT Protein (His Tag)Rat PDGFRB / PDGFR-1 Protein (His Tag)Cynomolgus EphB6 / EphB6 Protein (Fc Tag)Rat HER4 / ErbB4 Protein (Fc Tag)Rat TrkB / NTRK2 Protein (His Tag)Rat DDR2 Kinase / CD167b Protein (His Tag)Mouse CSF1R / MCSF Receptor / CD115 Protein (His & Fc Tag)Rat VEGFR2 / Flk-1 / CD309 / KDR Protein (Fc Tag)Rat VEGFR1 / FLT-1 Protein (His Tag)Rat DDR1 Kinase / MCK10 / CD167 Protein (His Tag)Rhesus EphA4 Protein (His Tag)Rhesus FGFR4 / FGF Receptor 4 Protein (Fc Tag)Rhesus FGFR1 / CD331 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (Fc Tag)Mouse FGFR2 / CD332 Protein (His Tag)Rat TrkA / NTRK1 Protein (His Tag)Mouse TrkA / NTRK1 Protein (Fc Tag)Rat PDGFRB / PDGFR-1 Protein (Fc Tag)Human MERTK / Mer(aa 578-872) ProteinHuman PDGFRB / PDGFR-1 / CD140b ProteinHuman EphB2 / Hek5 ProteinRat EphA7 / EHK3 Protein (His Tag)Mouse TrkA / NTRK1 Protein (His Tag)Rat DDR1 Kinase / MCK10 / CD167 Protein (Fc Tag)Rat TrkA / NTRK1 Protein (Fc Tag)Cynomolgus Tie2 / TEK Protein (Fc Tag)Human KIT / c-KIT / CD117 Protein (aa 50-190, His Tag)Rat c-MET / HGFR Protein (Fc Tag)Rhesus PDGFRB / PDGFR-1 Protein (His Tag)Rhesus DDR2 Kinase / CD167b Protein (His Tag)Mouse EphB2 / Hek5 Protein (Fc Tag)Human DDR2 Kinase / CD167b Protein (His Tag)Canine TrkB / NTRK2 Protein (His Tag)Rhesus DDR2 Kinase / CD167b Protein (Fc Tag)Rhesus FGFR4 / FGF Receptor 4 Protein (His Tag)Mouse FLT-3 / CD135 / FLK-2 Protein (His Tag)Canine TrkA / NTRK1 Protein (Fc Tag)Canine TrkA / NTRK1 Protein (His Tag)Canine HER2 / ErbB2 Protein (His Tag)Canine EGFR / HER1 / ErbB1 Protein (His Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (His Tag)Human HER3 / ErbB3 Protein (Fc Tag)Rat HER4 / ErbB4 Protein (His Tag)Rat PDGFRa / CD140a Protein (His Tag)Rhesus EphB1 / EPHT2 Protein (Fc Tag)Rat PDGFRa / CD140a Protein (Fc Tag)Rat CSF1R / MCSF Receptor / CD115 Protein (Fc Tag)Rhesus EphB1 / EPHT2 Protein (His Tag)Rhesus FGFR1 / CD331 Protein (His Tag)Human KIT / c-KIT / CD117 Protein (Fc Tag)Rhesus EGFR / HER1 / ErbB1 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (His Tag, ECD)Human FGFR3 / CD333 Protein (Fc Tag, ECD)Mouse EphB2 / Hek5 Protein (His Tag)Rat EphA7 / Eph Receptor A7 Protein (Fc Tag)
Background

Hepatocyte growth factor receptor (HGFR), also known as c-Met or mesenchymal-epithelial transition factor (MET), is a receptor tyrosine kinase (RTK) that has been shown to be overexpressed and/or mutated in a variety of malignancies. HGFR protein is produced as a single-chain precursor, and HGF is the only known ligand. Normal HGF/HGFR signaling is essential for embryonic development, tissue repair or wound healing, whereas aberrantly active HGFR has been strongly implicated in tumorigenesis, particularly in the development of invasive and metastatic phenotypes. HGFR protein is a multifaceted regulator of growth, motility, and invasion, and is normally expressed by cells of epithelial origin. Preclinical studies suggest that targeting aberrant HGFR signaling could be an attractive therapy in cancer.

References
  • McGill GG, et al. (2006) c-Met expression is regulated by Mitf in the melanocyte lineage. J Biol Chem. 281(15): 10365-73.
  • Garcia S, et al. (2007) c-Met overexpression in inflammatory breast carcinomas: automated quantification on tissue microarrays. British journal of cancer. 96(2): 329-35.
  • Socoteanu MP, et al. (2008) c-Met targeted therapy of cholangiocarcinoma. World J Gastroenterol. 14(19): 2990-4.
  • Kong DS, et al. (2009) Prognostic significance of c-Met expression in glioblastomas. Cancer. 115(1): 140-8.
  • Size / Price
    Catalog: MG50622-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"