After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Human FOLH1 ORF mammalian expression plasmid, N-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human FOLH1 cDNA Clone Product Information
Gene_bank_ref_id:NM_004476.1
RefSeq ORF Size:2253bp
cDNA Description:Full length Clone DNA of Homo sapiens folate hydrolase (prostate-specific membrane antigen) 1 with N terminal HA tag.
Gene Synonym:PSM, FGCP, FOLH, GCP2, PSMA, mGCP, GCPII, NAALAD1, NAALAdase
Species:Human
Vector:pCMV3-SP-N-HA
Plasmid:pCMV3-HA-FOLH1
Restriction Site:KpnI + XbaI (6kb + 2.34kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence except for the point mutations: 420A/T, 819T/C not causing the amino acid variation.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human FOLH1 Gene Plasmid Map
Human FOLH1 natural ORF mammalian expression plasmid, N-HA tag
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Glutamate carboxypeptidase 2, also known as Glutamate carboxypeptidase II, Membrane glutamate carboxypeptidase, Prostate-specific membrane antigen, GCPII, PSMA, FOLH1, and NAALAD1, is a single-pass type I I membrane protein which belongs to the peptidase M28 family and M28B subfamily. FOLH1 is highly expressed in prostate epithelium. It is detected in urinary bladder, kidney, testis, ovary, fallopian tube, breast, adrenal gland, liver, esophagus, stomach, small intestine, colon, brain (at protein level), and the capillary endothelium of a variety of tumors. FOLH1 has both folate hydrolase and N-acetylated alpha linked acidic dipeptidase (NAALADase) activity. It has a preference for tri-alpha-glutamate peptides. Genetic variation in FOLH1 may be associated with low folate levels and consequent hyperhomocysteinemia. This condition can result in increased risk of cardiovascular disease, neural tube defects, and cognitive deficits. FOLH1 also shows a promising role in directed imaging and therapy of recurrent or metastatic disease.

Size / Price
Catalog: HG15877-NY
List Price:   (Save )
Price:      [How to order]
AvailabilityIn StockShipping instructions
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"