Quick Order

Text Size:AAA

Mouse CDC42 ORF mammalian expression plasmid, N-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CDC42 cDNA Clone Product Information
Gene_bank_ref_id:NM_009861.3
RefSeq ORF Size:576bp
cDNA Description:Full length Clone DNA of Mus musculus cell division cycle 42 with N terminal His tag.
Gene Synonym:AI747189, AU018915
Species:Mouse
Vector:pCMV3-N-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Product nameProduct name
References
et al.
  • Shinjo K, et al. (1990) Molecular cloning of the gene for the human placental GTP-binding protein Gp (G25K): identification of this GTP-binding protein as the human homolog of the yeast cell-division-cycle protein CDC42. Proc Natl Acad Sci. 87(24):9853-7.
  • Munemitsu S, et al. (1990) Molecular cloning and expression of a G25K cDNA, the human homolog of the yeast cell cycle gene CDC42. Mol Cell Biol. 10(11):5977-82.
  • Walker S J, et al. (2000) Activation of phospholipase D1 by Cdc42 requires the Rho insert region. J Biol Chem. 275(21):15665-8.
  • Low B C, et al. (1999) Tyrosine phosphorylation of the Bcl-2-associated protein BNIP-2 by fibroblast growth factor receptor-1 prevents its binding to Cdc42GAP and Cdc42. J Biol Chem. 274(46): 33123-30.
  • Zhang B, et al. (1998) Interaction of Rac1 with GTPase-activating proteins and putative effectors. A comparison with Cdc42 and RhoA. J Biol Chem. 273(15):8776-82.
  • Size / Price
    Catalog: MG51481-NH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"