After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse CNTN4 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CNTN4 cDNA Clone Product Information
Gene_bank_ref_id:NM_001109749.1
RefSeq ORF Size:3081bp
cDNA Description:Full length Clone DNA of Mus musculus contactin 4 with C terminal HA tag.
Gene Synonym:Axcam, BIG-2, 9630050B05, Cntn4
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Contactin-4, abbreviated as CNTN4, is a brain-derived protein belonging to the immunoglobulin superfamily. It has been found high expression in testes, thyroid, small intestine, uterus and brain. This protein is an neuronal membrane protein that functions as an glycosylphosphatidylinositol- anchored cell adhesion molecule. Contactin-4 is considered as a candidate protein responsible for the differentiation potential of human neuroblastoma cells and it has been implicated in some cases of autism and spinocerebellar ataxia type 16. Studies of the cantactin family have revealed a complex pattern of hemophilic and heterophilic interactions that are required for axon growth and pathfinding. Such studies demonstrate that these essential functions are mediated by the combination and juxtaposition of multiple Ig and FNIII domains. Second, these neuronal adhesion molecules demonstrate highly regulated temporal and spatial expression patterns in the CNS. For this reason, the disruption of the regulatory region of the predominant brain-expressed isoform reasonable would be expected to have significant functional consequences. 

References
  • Zeng L, et al. (2002) A novel splice variant of the cell adhesion molecule contactin 4 ( CNTN4) is mainly expressed in human brain. J Hum Genet. 47 (9): 497-9.
  • Thomas Fernandez, et al. (2004) Disruption of Contactin 4 (CNTN4) Results in Developmental Delay and Other Features of 3p Deletion Syndrome. Am J Hum Genet. 74 (6): 1286-93.
  • Yoshihara Y, et al. (1996) Overlapping and differential expression of BIG-2, BIG-1, TAG-1, and F3: four members of an axon-associated cell adhesion molecule subgroup of the immunoglobulin superfamily. J Neurobiol. 28 (1): 51-69.
  • Size / Price
    Catalog: MG50570-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"