Quick Order

Text Size:AAA

Mouse ENPP-7 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse ENPP7 cDNA Clone Product Information
Gene_bank_ref_id:NM_001030291.1
RefSeq ORF Size:1341bp
cDNA Description:Full length Clone DNA of Mus musculus ectonucleotide pyrophosphatase/phosphodiesterase 7 with C terminal HA tag.
Gene Synonym:Gm254, Alk-SMase, Enpp7
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Mouse Ectonucleotide pyrophosphatase / phosphodiesterase family member 7, also known as Alkaline sphingomyelin phosphodiesterase, Intestinal alkaline sphingomyelinase, Alk-Smase, ENPP7 and NPP-7, is a single-pass type I membrane protein which belongs to the nucleotide pyrophosphatase / phosphodiesterase family. ENPP7 / NPP-7 is expressed in the intestines and human bile. ENPP7 / NPP-7 is localized at the surface of the microvillar membrane in small intestine enterocytes, as well as in endosome-like structures and in Golgi complex. The main function of ENPP7 / NPP-7 is to convert the dietary sphingomyelin into ceramide, the sphingolipid messengers via hydrolyzation. ENPP7 / NPP-7 is also reported to exert a phospholipase C activity toward palmitoyl lyso-phosphocholine. The activity of this enzyme is inhibited in a dose dependent manner by ATP, imidazole, orthovanadate and zinc ion. Further, It has been shown in studies that decreased levels of ENPP7 / NPP-7 may be associated with human colon cancer.

References
  • Wu J. et al., 2005, Biochem. J. 386:153-60.
  • Wu J. et al., 2004, Carcinogenesis 25:1327-33.
  • Duan R.-D. et al., 2003, J. Lipid Res. 44:1241-50.
  • Duan R.-D. et al., 2003, J. Biol. Chem. 278:38528-36.
  • Size / Price
    Catalog: MG50567-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"