Quick Order

Text Size:AAA

Human HSP90AB1 natural ORF mammalian expression plasmid

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Human HSP90AB1 cDNA Clone Product Information
Gene_bank_ref_id:NM_007355.3
RefSeq ORF Size:2175bp
cDNA Description:Full length Clone DNA of Homo sapiens heat shock protein 90kDa alpha (cytosolic), class B member 1.
Gene Synonym:HSPC2, HSPCB, D6S182, HSP90B, FLJ26984, HSP90-BETA, HSP90AB1
Species:Human
Vector:pCMV/hygro
Plasmid:pCMV-HSP90AB1
Restriction Site:KpnI (two restriction sites) + XbaI (5.5kb + 0.54kb + 1.65kb)
Tag Sequence:
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Ampicilin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Human HSP90AB1 Gene Plasmid Map
Human HSP90AB1 Gene cDNA Clone (full-length ORF Clone), expression ready, untagged
pCMV/hygro Vector Information
 
Vector Name pCMV/hygro
Vector Size 5657bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Ampicillin
Selection In Mammalian Cells Hygromycin
Protein Tag None
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)


Schematic of pCMV/hygro Multiple Cloning Sites
Product nameProduct name
Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"