Quick Order

Text Size:AAA

Mouse GPA33 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GPA33cDNA Clone Product Information
cDNA Size:960
cDNA Description:ORF Clone of Mus musculus glycoprotein A33 (transmembrane) DNA.
Gene Synonym:BB116197, 2010310L10Rik, 2210401D16Rik, Gpa33
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Cell surface A33 antigen, also known as glycoprotein A33, is a single-pass type I  membrane protein which is expressed in normal gastrointestinal epithelium and in 95% of colon cancers. GPA33 contains one Ig-like C2-type (immunoglobulin-like) domain and one Ig-like V-type (immunoglobulin-like) domain. The open reading frame encodes a 319-amino acid polypeptide having a putative secretory signal sequence and 3 potential glycosylation sites. The predicted mature protein has a 213-amino acid extracellular region, a single transmembrane domain, and a 62-amino acid intracellular tail. Intracellular traffic and recycling to the cell surface appear to play a major role in GPA33 function and to have an influence on its surface density superseding translational regulation. GPA33 has become a promising target of immunologic therapy strategies, but its biologic function and potential role in tumorigenesis are unknown. EpCAM protein and GPA33 mRNA expressions are specific and sensitive markers of Barrett's metaplasia (BM). GPA33 may also play a role in cell-cell recognition and signaling.

  • Heath J.K., et al., 1997, Proc. Natl. Acad. Sci. USA. 94:469-74.
  • Ritter G., et al., 1997, Biochem. Biophys. Res. Commun. 236:682-6.
  • Frey,D. et al., 2008, Cancer Biother Radiopharm  23 (1):65-73.
  • Rageul,J. et al., 2009, Int J Cancer 125 (12):2802-9. 
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items