Quick Order

Text Size:AAA

Rat CD9 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CD9 cDNA Clone Product Information
Gene_bank_ref_id:NM_053018.1
RefSeq ORF Size:681bp
cDNA Description:Full length Clone DNA of Rattus norvegicus CD9 molecule with N terminal Myc tag.
Gene Synonym:Cd9
Species:Rat
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. CD9 is a member of the transmembrane 4 superfamily, which is also known as the tetraspanin family. CD9 is a cell surface glycoprotein with 4 hydrophobic domains that is described to complex with integrins and other transmembrane 4 superfamily members. It is found expressed on the surface of the exosomes. The protein takes part in cellular signal transduction events and thus play a role in the regulation of cell development and activation, growth and motility. Besides, CD9 seems to be a key role in the egg-sperm fusion during the mammalian fertilization processes. CD9 is found on the membrane of the oocytes and also appears to intervene in maintaining the normal shape of oocyte microvilli.

References
  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12
  • Franois Le Naour, et al. (2000) Severely Reduced Female Fertility in CD9-Deficient Mice. Science. 287(5451): 319-21.
  • Size / Price
    Catalog: RG80778-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"