After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat FDPS ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat FDPS cDNA Clone Product Information
Gene_bank_ref_id:NM_031840.1
RefSeq ORF Size:1062bp
cDNA Description:Full length Clone DNA of Rattus norvegicus farnesyl diphosphate synthase with N terminal Myc tag.
Gene Synonym:FPS, Ac2-125
Species:Rat
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Z-farnesyl diphosphate synthase (FDPS) is an enzyme belonging to the family of transferases, specifically those transferring aryl or alkyl groups other than methyl groups. Z-farnesyl diphosphate synthase (FDPS) functions as key enzyme in isoprenoid biosynthesis which catalyzes the formation of farnesyl diphosphate, a precurcor for several classes of essential metabolites. FDPS catalyzes the production of geranyl pyrophosphate and farnesyl pyrophosphate from isopentenyl pyrophosphate and dimethylallyl pyrophosphate. The resulting product, farnesyl pyrophosphate, is a key intermediate in cholesterol and sterol biosynthesis, a substrate for protein farnesylation and geranylgeranylation, and a ligand or agonist for certain hormone receptors and growth receptors. Drugs that inhibit this enzyme prevent the post-translational modifications of small GTPases and have been used to treat diseases related to bone resorption. Functions of FDPS may be inactivated by interferon-induced RSAD2. This inactivation may result of disruption of lipid rafts at the plasma membrane, and thus have an antiviral effect since many enveloped viruses need lipid rafts to bud efficiently out of the cell.

References
  • Pjetursson BE, et al. (2007) Comparison of survival and complication rates of tooth-supported fixed dental prostheses (FDPs) and implant-supported FDPs and single crowns (SCs). Clin Oral Implants Res. 3:97-113.
  • Eschbach S, et al. (2009) Clinical evaluation of all-ceramic posterior three-unit FDPs made of In-Ceram Zirconia. Int J Prosthodont. 22(5):490-2.
  • Moshage HJ, et al. (1990) Differential effects of endotoxin and fibrinogen degradation products (FDPS) on liver synthesis of fibrinogen and albumin: evidence for the involvement of a novel monokine in the stimulation of fibrinogen synthesis induced by FDPS. Int J Biochem. 22(12): 1393-400.
  • Size / Price
    Catalog: RG80771-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"