After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse PLS3 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PLS3cDNA Clone Product Information
cDNA Size:1893
cDNA Description:ORF Clone of Mus musculus plastin 3 (T-isoform) DNA.
Gene Synonym:AI115446, AL024105, T-fimbrin
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name

PLS3, also known as plastin 3, belongs to the plastin family. Members of this family are actin-binding proteins that are conserved throughout eukaryote evolution and expressed in most tissues of higher eukaryotes. There are two ubiquitous plastin isoforms in humans: L and T. The L isoform is expressed only in hemopoietic cell lineages, while the T isoform has been found in all other normal cells of solid tissues that have replicative potential (fibroblasts, endothelial cells, epithelial cells, melanocytes, etc.). PLS3 contains 2 actin-binding domains, 4 CH (calponin-homology) domains and 2 EF-hand domains. It is expressed in a variety of organs, including muscle, brain, uterus and esophagus.

  • Lin CS. et al., 1993, J Biol Chem 268 (4): 2781-92.
  • Goldstein D. et al., 1985, Cancer Res. 45 (2): 5643-7.
  • Arpin M. et al., 1995, J Cell Biol. 127 (2): 1995-2008.
  • Size / Price
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items