Quick Order

Rat EIF5A ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat EIF5A cDNA Clone Product Information
Gene_bank_ref_id:NM_001033681.1
RefSeq ORF Size:465bp
cDNA Description:Full length Clone DNA of Rattus norvegicus eukaryotic translation initiation factor 5A with N terminal Myc tag.
Gene Synonym:Eif5a
Species:Rat
Vector:pCMV3-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

EIF-5A, also known as EIF5, functions in start site selection as a GTPase accelerating protein (GAP) for the eukaryotic translation initiation factor (eIF) 2•GTP•tRNA ternary complex within the ribosome-bound pre-initiation complex. In protein synthesis initiation, eIF2 functions in its GTP-bound state to deliver initiator methionyl-tRNA to the small ribosomal subunit and is necessary for protein synthesis in all cells. EIF-5A stabilizes the binding of GDP to eIF2 and is therefore a bi-functional protein that acts as a GDP dissociation inhibitor (GDI). EIF-5A also interacts with eIF1 and eIF3 and binds the eIF2-GTP/Met-tRNA ternary complex along with the 40S ribosome subunit.

References
  • Jenkins ZA. et al., 2001, Genomics. 71 (1): 101-9.
  • Guan XY. et al., 2001, Cancer Res. 61 (9): 3806-9.
  • Strausberg RL. et al., 2003, Proc Natl Acad Sci. 99 (26): 16899-903.
  • Clement PM. et al., 2003, Eur J Biochem. 270 (21): 4254-63.
  • Size / Price
    Catalog: RG80501-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"