Quick Order

Rat SUMO1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SUMO1cDNA Clone Product Information
cDNA Size:306
cDNA Description:ORF Clone of Rattus norvegicus SMT3 suppressor of mif two 3 homolog 1 (S. cerevisiae) DNA.
Gene Synonym:Sumo1
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name

Small ubiquitin-like modifier protein (SUMO) modification is a highly dynamic process, catalyzed by SUMO-specific activating (E1), conjugating (E2) and ligating (E3) enzymes, and reversed by a family of SUMO-specific proteases (SENPs). Small ubiquitin-like modifier 1 (SUMO1) is a member of the superfamily of ubiquitin-like proteins. Despite its structural similarity with ubiquitin, SUMO1 does not seem to play any role in protein degradation. SUMO1 plays an important role in modulation of NOX activity required for ROS generation. SUMO1 haploinsufficiency results in cleft lip and palate in animal models. SUMO1 gene variation in human non-syndromic cleft lip with or without cleft palate (NSCLP) development. SUMO-1 may be useful as a novel target for therapy in oral squamous cell carcinoma (SCC) as well as a clinical indicator for tumor recurrence together with Mdm2.

  • Kim HJ, et al. (2011) SUMO1 attenuates stress-induced ROS generation by inhibiting NADPH oxidase 2. Biochem Biophys Res Commun. 410(3): 555-62.
  • Zuo Y, et al. (2009) Small ubiquitin-like modifier protein-specific protease 1 and prostate cancer. Asian J Androl. 11(1): 36-8.
  • Song T, et al. (2008) SUMO1 polymorphisms are associated with non-syndromic cleft lip with or without cleft palate. Biochem Biophys Res Commun. 377(4): 1265-8.
  • Katayama A, et al. (2007) Overexpression of small ubiquitin-related modifier-1 and sumoylated Mdm2 in oral squamous cell carcinoma: possible involvement in tumor proliferation and prognosis. Int J Oncol. 31(3): 517-24.