Quick Order

Rat COLEC12 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat COLEC12 cDNA Clone Product Information
Gene_bank_ref_id:NM_001025721.1
RefSeq ORF Size:2229bp
cDNA Description:Full length Clone DNA of Rattus norvegicus collectin sub-family member 12 with N terminal Myc tag.
Gene Synonym:MGC114569, Colec12
Species:Rat
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CLP1, also known as COLEC12, is a scavenger receptor that displays several functions associated with host defense. It contains 1 C-type lectin domain and 3 collagen-like domains. CLP1 is strongly expressed in placenta and moderately expressed in heart, skeletal muscle, small intestine and lung. It promotes binding and phagocytosis of Gram-positive, Gram-negative bacteria and yeast. CLP1 mediates the recognition, internalization and degradation of oxidatively modified low density lipoprotein (oxLDL) by vascular endothelial cells. It binds to several carbohydrates including Gal-type ligands, D-galactose, L- and D-fucose, GalNAc, T and Tn antigens in a calcium-dependent manner and internalizes specifically GalNAc in nurse-like cells. It binds also to sialyl Lewis X or a trisaccharide and asialo-orosomucoid (ASOR). CLP1 may also play a role in the clearance of amyloid beta in Alzheimer disease.

References
  • Ramirez A, et al. (2008) Human RNA 5'-kinase (hClp1) can function as a tRNA splicing enzyme in vivo. RNA. 14(9):1737-45.
  • Danielsen JM, et al.. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  •  

    Size / Price
    Catalog: RG80394-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"