Quick Order

Rat ICOS ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat ICOS cDNA Clone Product Information
Gene_bank_ref_id:NM_022610.1
RefSeq ORF Size:603bp
cDNA Description:Full length Clone DNA of Rattus norvegicus inducible T-cell co-stimulator with N terminal Myc tag.
Gene Synonym:Ailim, Icos
Species:Rat
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Inducible costimulator (ICOS), also called AILIM (activiation-inducible lymphocyte immunomediatory molecule) is a cell-surface receptor, and belongs to the CD28 family of immune costimulatory receptors consisting of CD28, CTLA-4 and PD-1. The interaction of B7-H2/ICOS plays a critical role in Th cell differentiation, T−B cell interactions which is essential for germinal center formation, and humoral immune responses, and as well as the production of cytokine IL-4. In addition, ICOS is more potent in the induction of IL-10 production, a cytokine important for suppressive function of T regulatory cells. The B7-1/B7-2--CD28/CTLA-4 and ICOS-B7RP-1 pathway provides key second signals that can regulate the activation, inhibition and fine-tuning of T-lymphocyte responses. ICOS stimulates both Th1 and Th2 cytokine production but may have a preferential role in Th2 cell development. Moreover, The B7-1/B7-2-CD28/CTLA-4 and ICOS-B7RP-1 pathway has been suggested of being involved in the development of airway inflammation and airway hyperresponsiveness.

References
  • Coyle AJ, et al. (2004) The role of ICOS and other costimulatory molecules in allergy and asthma. Springer Semin Immunopathol. 25(3-4): 349-59.
  • Chen YQ, et al. (2006) CD28/CTLA-4--CD80/CD86 and ICOS--B7RP-1 costimulatory pathway in bronchial asthma. Allergy. 61(1): 15-26.
  • van Berkel ME, et al. (2006) CD28 and ICOS: similar or separate costimulators of T cells Immunol Lett. 105(2): 115-22.
  • Size / Price
    Catalog: RG80381-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"