Quick Order

Text Size:AAA

Mouse GFAP Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
GFAPcDNA Clone Product Information
Gene_bank_ref_id:NM_001131020.1
cDNA Size:1293
cDNA Description:ORF Clone of Mus musculus glial fibrillary acidic protein DNA.
Gene Synonym:AI836096
Species:Mouse
Vector:pCMV3-C-His
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-His Vector Information
 
Vector Name pCMV3-C-His
Vector Size 6164bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag His
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-C-His Physical Map

Schematic of pCMV3-C-His Multiple Cloning Sites

His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokaryotic expression systems.

Related Products
Product nameProduct name
Background

GFAP is a cell-specific marker which belongs to the intermediate filament family. It can distinguish astrocytes from other glial cells during development. GFAP is expressed in cells lacking fibronectin. It is a type III intermediate filaments protein which contains three domains: the head, rod and tail domains. GFAP functions in many important entral nervous system (CNS) processes, including cell communication and the functioning of the blood brain barrier. Improper GFAP regulation can cause multiple disorders. Defects in GFAP is related to Alexander disease which is a rare disorder of the central nervous system. It is a progressive leukoencephalopathy whose hallmark is the widespread accumulation of Rosenthal fibers which are cytoplasmic inclusions in astrocytes.

References
  • Buniatian G, et al., 1998, Biology of the cell. 90(1): 53-61.
  • Chen YS, et al., 2011, Experimental Cell Research. 317(16): 2252-66.
  • Isaacs A, et al., 1998, Genomics. 51(1): 152-4.
  • Size / Price
    Catalog:MG52126-CH
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"