After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat MSR1 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat MSR1 cDNA Clone Product Information
Gene_bank_ref_id:NM_001191939.1
RefSeq ORF Size:1365bp
cDNA Description:Full length Clone DNA of Rattus norvegicus macrophage scavenger receptor 1 with N terminal Myc tag.
Gene Synonym:RGD1564316, Msr1
Species:Rat
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

Macrophage scavenger receptor types I and II, also known as Macrophage acetylated LDL receptor I and II, Scavenger receptor class A member 1, CD204, MSR1 and SCARA1, is a single-pass type I I membrane protein which contains one collagen-like domain and one SRCR domain. Macrophages are distributed in all peripheral tissues and play a critical role in the first line of the innate immune defenses against bacterial infection by phagocytosis of bacterial pathogens through the macrophage scavenger receptor 1 (MSR1). MSR1 / SCARA1 is one of the membrane glycoproteins implicated in the pathologic deposition of cholesterol in arterial walls during atherogenesis. Two types of receptor subunits exist. These receptors mediate the endocytosis of a diverse group of macromolecules, including modified low density lipoproteins (LDL). MSR1 / SCARA1 is also involved in chronic inflammation which is a risk factor for prostate cancer. MSR1 1 gene was identified as a candidate susceptibility gene for hereditary prostate cancer and as a risk factor for sporadic prostate cancer.

References
  • Wang L. et al., 2003, Nat Genet. 35 (2): 128-9.
  • Chen Y.C. et al., 2008, Cancer Epidemiol Biomarkers Prev. 17 (4): 1001-3.
  • Shirato K. et al., 2009, Pflugers Arch. 459 (1): 93-103.
  • Sun J. et al., 2006, Prostate. 66 (7): 728-37.
  • Size / Price
    Catalog: RG80363-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"