After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Mouse RSPO1 ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse RSPO1 cDNA Clone Product Information
Gene_bank_ref_id:NM_138683.1
RefSeq ORF Size:798bp
cDNA Description:Full length Clone DNA of Mus musculus R-spondin homolog (Xenopus laevis) with C terminal HA tag.
Gene Synonym:Rspondin, R-spondin, Rspo1
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:pCMV3-mRSPO1-HA
Restriction Site:KpnI + XbaI (6kb + 0.84kb)
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:Identical with the Gene Bank Ref. ID sequence.
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Background

RSPO1 gene is a member of the R-spondin family. It encodes RSPO1 which is known as a secreted activator protein with two cystein-rich, furin-like domains and one thrombospondin type 1 domain. In mice, RSPO1 induces the rapid onset of crypt cell proliferation and increases intestinal epithelial healing, providing a protective effect against chemotherapy-induced adverse effects. This protein is an activator of the beta-catenin signaling cascade, leading to TCF-dependent gene activation. RSPO1 acts both in the canonical Wnt/beta-catenin-dependent pathway and in non-canonical Wnt signaling pathway, probably by acting as an inhibitor of ZNRF3, an important regulator of the Wnt signaling pathway. It also acts as a ligand for frizzled FZD8 and LRP6.

References
  • Kamata T, et al. (2004) R-spondin, a novel gene with thrombospondin type 1 domain, was expressed in the dorsal neural tube and affected in Wnts mutants. Biochim Biophys Acta. 1676(1):51-62.
  • Ota T, et al. (2004) Complete sequencing and characterization of 21,243 full-length human cDNAs. Nat Genet. 36(1):40-5.
  • Strausberg RL, et al. (2003) Generation and initial analysis of more than 15,000 full-length human and mouse cDNA sequences. Proc Natl Acad Sci. 99(26):16899-903.
  • Size / Price
    Catalog: MG50316-CY
    List Price:   (Save )
    Price:      [How to order]
    AvailabilityIn StockShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"