Quick Order

Mouse SERPINA10 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
SERPINA10cDNA Clone Product Information
cDNA Size:1347
cDNA Description:ORF Clone of Mus musculus serine (or cysteine) peptidase inhibitor, clade A (alpha-1 antiproteinase, antitrypsin), member 10 DNA.
Gene Synonym:PZI, ZPI, MGC25863, Serpina10
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Mouse protein Z-dependent protease inhibitor, also known as PZ-dependent protease inhibitor, SERPINA10 and ZPI, is a secreted protein which belongs to the serpin family. It is expressed by the liver and secreted in plasma. SERPINA10 / Serpin-A10 inhibits factor Xa activity in the presence of protein Z, calcium and phospholipid. Serpins are a group of proteins with similar structures that were first identified as a set of proteins able to inhibit proteases. The acronym serpin was originally coined because many serpins inhibit chymotrypsin-like serine proteases (serine protease inhibitors).Over 1000 serpins have now been identified, these include 36 human proteins, as well as molecules in plants, fungi, bacteria, archaea and certain viruses. Serpins are the largest and most diverse family of protease inhibitors. Most serpins control proteolytic cascades, certain serpins do not inhibit enzymes, but instead perform diverse functions such as storage (ovalbumin, in egg white), hormone carriage proteins (thyroxine-binding globulin, cortisol-binding globulin) and tumor suppressor genes (maspin). Most inhibitory serpins target chymotrypsin-like serine proteases. These enzymes are defined by the presence of a nucleophilic serine residue in their catalytic site. Some serpins inhibit other classes of protease. A number of such serpins have been shown to target cysteine proteases. These enzymes differ from serine proteases in that they are defined by the presence of a nucleophilic cysteine residue, rather than a serine residue, in their catalytic site.

  • Han X, et al., 1998, Proc Natl Acad Sci. USA  95: 9250-5.
  • Han X, et al., 2000, Blood 96: 3049-55.
  • Irving JA, et al.,2000, Genome Res. 10 (12): 1845-64.
  • Irving J, et al.,2002, Mol Biol Evol. 19 (11): 1881-90.
  • Rawlings ND, et al.,2004, Biochem J. 378 (Pt 3): 705-16.
  • Water N, et al., 2004, Br J Haematol. 127:190-4.
  • Wei Z, et al., 2009, Blood 114 (17): 3662-7.
  • Whisstock JC, et al.,2010, J Biol Chem. 285 (32): 24307-12.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items