Quick Order

Rat LILRA5 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
LILRA5cDNA Clone Product Information
Gene_bank_ref_id:NM_001076793.1
cDNA Size:888
cDNA Description:ORF Clone of Rattus norvegicus leukocyte immunoglobulin-like receptor, subfamily A (with TM domain), member 5 DNA.
Gene Synonym:Lilrc1, Lilra5
Species:Rat
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

LILRA5 is a member of the leukocyte immunoglobulin-like receptor (LIR) family. LILR are a family of receptors possessing extracellular immunoglobulin domains. They are also known as CD85, ILTs and LIR, and can exert immunomodulatory effects on a wide range of immune cells. ILT-11 contains 2 Ig-like C2-type (immunoglobulin-like) domains. It can be detected n tissues of the hematopoietic system, including bone marrow, spleen, lymph node and peripheral leukocytes. Crosslink of ILT-11 on the surface of monocytes has been shown to induce calcium flux and secretion of several proinflammatory cytokines, which suggests the roles of this protein in triggering innate immune responses.

References
  • Wende H, et al. (2000) Extensive gene duplications and a large inversion characterize the human leukocyte receptor cluster. Immunogenetics. 51(8-9):703-13.
  • Jones DC, et al. (2009) Alternative mRNA splicing creates transcripts encoding soluble proteins from most LILR genes. Eur J Immunol. 39(11):3195-206.
  • Mosbruger TL, et al. (2010) Large-scale candidate gene analysis of spontaneous clearance of hepatitis C virus. J Infect Dis. 201(9):1371-80.
  • Size / Price
    Catalog:RG80334-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"