Quick Order

Text Size:AAA

Mouse CCDC47 ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse CCDC47 cDNA Clone Product Information
NCBI RefSeq:NM_026009.2
RefSeq ORF Size:1452bp
cDNA Description:Full length Clone DNA of Mus musculus coiled-coil domain containing 47 with C terminal His tag.
Gene Synonym:asp4, C88307, calumin, 2610204L23Rik, RP23-81G14.10
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

CCDC47 gene is expressed at high level. The gene contains 16 distinct gt-ag introns. Transcription produces 9 different mRNAs, 6 alternatively spliced variants and 3 unspliced forms. There are 3 probable alternative promotors, 3 non overlapping alternative last exons and 8 validated alternative polyadenylation sites. The mRNAs appear to differ by truncation of the 5' end, truncation of the 3' end, presence or absence of a cassette exon, overlapping exons with different boundaries. Functionally, CCDC47 gene has been proposed to participate in processes such as calcium ion homeostasis, embryo development, ER overload response and post-embryonic development. CCDC47 are expected to have molecular function (calcium ion binding) and to localize in various compartments (membrane, endoplasmic reticulum, integral to membrane, microsome).

References
  • Danielsen JM, et al. (2011) Mass spectrometric analysis of lysine ubiquitylation reveals promiscuity at site level. Mol Cell Proteomics. 10(3):M110.003590.
  • Kim W, et al. (2011) Systematic and quantitative assessment of the ubiquitin-modified proteome. Mol Cell. 44(2):325-40.
  • Size / Price
    Catalog: MG52105-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    All information of our products is subject to change without notice. Please refer to COA enclosed in shipped package for the newest information.
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"