After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat CD47 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
CD47cDNA Clone Product Information
Gene_bank_ref_id:NM_019195.2
cDNA Size:912
cDNA Description:ORF Clone of Rattus norvegicus Cd47 molecule DNA.
Gene Synonym:Itgp, MGC93490, Cd47
Species:Rat
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

CD47 contains 1 Ig-like V-type (immunoglobulin-like) domain and is a receptor for the C-terminal cell binding domain of thrombospondin. It may play a role in membrane transport and signal transduction. CD47 is also a membrane protein, which is involved in the increase in intracellular calcium concentration that occurs upon cell adhesion to extracellular matrix. It is very broadly distributed on normal adult tissues, as well as ovarian tumors, being especially abundant in some epithelia and the brain. CD47 may play a role in membrane transport and/or integrin dependent signal transduction. It may prevent premature elimination of red blood cells. It also may be involved in membrane permeability changes induced following virus infection. By acting as an adhesion receptor for THBS1 on platelets, CD47 plays a role in both cell adhesion and in the modulation of integrins. It also plays an important role in memory formation and synaptic plasticity in the hippocampus.

References
  • Brown EJ, et al. (2001) Integrin-associated protein (CD47) and its ligands. Trends Cell Biol. 11(3): 130-5.
  • Oldenborg PA. (2004) Role of CD47 in erythroid cells and in autoimmunity. Leuk Lymphoma. 45(7): 1319-27.
  • Kaczorowski DJ, et al. (2007) Targeting CD47: NO limit on therapeutic potential. Circ Res. 100(5): 602-3.
  • Size / Price
    Catalog:RG80305-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"