Quick Order

Text Size:AAA

Rat CD28 ORF mammalian expression plasmid, N-Myc tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Rat CD28 cDNA Clone Product Information
Gene_bank_ref_id:NM_013121.1
RefSeq ORF Size:657bp
cDNA Description:Full length Clone DNA of Rattus norvegicus Cd28 molecule with N terminal Myc tag.
Gene Synonym:CD28RNA, Cd28
Species:Rat
Vector:pCMV3-SP-N-Myc
Plasmid:
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Product nameProduct name
Background

CD28 (Cluster of Differentiation 28) is a disulphide-bonded glycoprotein belonging to the immunoglobulin (Ig) superfamily, and structurally consists of a single Ig V-like extracellular domain, a transmembrane domain and an intracellular domain. Mouse CD28 is constitutively expressed on the surface of all murine T cells and on developing thymocytes as disulfide-linked homodimers or as monomers. CD28 can binds the B7-1 and B7-2 ligand, and together perform important functions in the T and B cell response pathways. B7/CD28 family members, which can augment or antagonize T-cell receptor signaling, in the regulation of central and peripheral T-cell tolerance. CD28 is thus involved in T-cell activation, the induction of cell proliferation and cytokine production and promotion of T-cell survival.

References
  • Keir ME, et al. (2005) The B7/CD28 costimulatory family in autoimmunity. Immunol Rev. 204: 128-43.
  • Sansom DM, et al. (2006) The role of CD28 and cytotoxic T-lymphocyte antigen-4 (CTLA-4) in regulatory T-cell biology. Immunol Rev. 212: 131-48.
  • Bjrgo E, et al. (2010) Novel mechanism of signaling by CD28. Immunol Lett. 129(1): 1-6.
  • Size / Price
    Catalog: RG80302-NM
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"