After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PTPRCcDNA Clone Product Information
cDNA Size:3426
cDNA Description:ORF Clone of Rattus norvegicus protein tyrosine phosphatase, receptor type, C, transcript variant 1 DNA.
Gene Synonym:Lca, RT7, CD45, L-CA, T200, Ptprc
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-N-Myc Vector Information
Vector Name pCMV3-N-Myc
Vector Size 6104bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive ,Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-N-Myc Physical Map

Schematic of pCMV3-N-Myc Multiple Cloning Sites

Myc Tag Info

A myc tag is a polypeptide protein tag derived from the c-myc gene product that can be added to a protein using recombinant DNA technology. It can be used for affinity chromatography, then used to separate recombinant, overexpressed protein from wild type protein expressed by the host organism. It can also be used in the isolation of protein complexes with multiple subunits.

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged on other vectors
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-GFPSpark-taggedRG80296-ACG$425
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-OFPSpark tagRG80296-ACR$425
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-GFPSpark-taggedRG80296-ANG$425
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-OFPSpark tagRG80296-ANR$425
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-FLAG-taggedRG80296-CF$395
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-His-taggedRG80296-CH$395
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-Myc-taggedRG80296-CM$395
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-taggedRG80296-CY$395
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone)RG80296-G$295
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-FLAG-taggedRG80296-NF$395
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-His-taggedRG80296-NH$395
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-taggedRG80296-NM$395
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-HA-taggedRG80296-NY$395
Rat PTPRC transcript variant 1 Gene cDNA Clone (full-length ORF Clone), expression ready, untaggedRG80296-UT$395
 Learn more about expression Vectors
Related Products
Product nameProduct name

The cluster of differentiation (CD) system is commonly used as cell markers in immunophynotyping. Different kinds of cells in the immune system can be identified through the surface CD molecules which associating with the immune function of the cell. There are more than 320 CD unique clusters and subclusters have been identified. Some of the CD molecules serve as receptors or ligands important to the cell through initiating a signal cascade which then alter the behavior of the cell. Some CD proteins do not take part in cell signal process but have other functions such as cell adhesion. Protein tyrosine phosphatase, receptor type C (CD45), also known as PTPRC is a member of the protein tyrosine phosphatase (PTP) family which is known for its function to serve as signaling molecules and to regulate a variety of cellular processes such as cell proliferation, differentiation, mitotic cycle and oncogenic transformation. CD45 is found expression specifically in hemotopietic cells. CD45 consists of an extracellular domain, a single transmembrane segment and two tandem intracytoplasmic catalytic domains. It serves as an essential regulator of T-cell and B-cell antigen receptor signaling through either direct interaction with components of the antigen receptor complexs or by activating various Src family kinases required for the antigen receptor signaling and it also can suppress JAK kinases.

  • Zola H, et al. (2007) CD molecules 2006-human cell differentiation molecules. J Immunol Methods. 318 (1-2): 1-5.
  • Ho IC, et al. (2009) GATA3 and the T-cell lineage: essential functions before and after T-helper-2-cell differentiation. Nat Rev Immunol. 9 (2): 125-35.
  • Matesanz-Isabel J, et al. (2011) New B-cell CD molecules. Immunology Letters.134 (2): 104-12.
  • Irie-Sasaki J, et al. (2001) CD45 is a JAK phosphatase and negatively regulates cytokine receptor signaling. Nature. 409: 349-54.
  • Size / Price
    List Price: $395.00  (Save $0.00)
    Price:$395.00      [How to order]
    Availability2-3 weeks