After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Mouse MARCO ORF mammalian expression plasmid, C-HA tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse MARCO cDNA Clone Product Information
Gene_bank_ref_id:NM_010766.2
RefSeq ORF Size:1557bp
cDNA Description:Full length Clone DNA of Mus musculus macrophage receptor with collagenous structure with C terminal HA tag.
Gene Synonym:Ly112, Scara2, AI323439, Marco
Species:Mouse
Vector:pCMV3-C-HA
Plasmid:
Restriction Site:
Tag Sequence:HA Tag Sequence: TATCCTTACGACGTGCCTGACTACGCC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Product nameProduct name
Background

Macrophage receptor MARCO, also known as Macrophage receptor with collagenous structure and Marco, is a single-pass type I I membrane protein. MARCO is a member of the class A scavenger receptor family and is part of the innate antimicrobial immune system. It is expressed in subpopulations of macrophages in the spleen and the medullary cord of lymph nodes. Although it is expressed on subsets of macrophages, it can be upregulated on other macrophages after bacterial infection. The strategic position of MARCO-expressing cells in lymphoid organs suggests an important role for this bacteria-binding molecule in removal of pathogens. MARCO has a short N-terminal cytoplasmic domain, a transmembrane domain, and a large extracellular part composed of a 75-residue long spacer domain, a 270-residue collagenous domain, and a 99-residue long scavenger receptor cysteine-rich (SRCR) domain. It is possible that cooperation between the SRCR domain and the collagenous domain is needed for high-affinity bacterial binding, or that the SRCR domain has to be in a trimeric form to effectively bind to bacteria

References
  • Kraal, G. et al., 2000, Microbes Infect . 2 (3): 313-6.
  • Sankala, M., 2002, J Biol Chem. 277 (36): 33378-85.
  • Arredouani, MS., 2004, Cell Mol Biol. 50 Online Pub : OL657-65.
  • Thakur, SA., 2009, Toxicol Sci. 107 (1): 238-46.
  • Size / Price
    Catalog: MG50283-CY
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"