Quick Order

Mouse AGRP Gene cDNA Clone (full-length ORF Clone), expression ready, C-HA-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
AGRPcDNA Clone Product Information
cDNA Size:396
cDNA Description:ORF Clone of Mus musculus agouti related protein DNA.
Gene Synonym:Art, Agrt, Agrp
Restriction Site:
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-C-HA Vector Information
Vector Name pCMV3-C-HA
Vector Size 6161bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag HA
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)

pCMV3-C-HA Physical Map
Schematic of pCMV3-C-HA Multiple Cloning Sites

HA Tag Info

Human influenza hemagglutinin (HA) is a surface glycoprotein required for the infectivity of the human virus. The HA tag is derived from the HA-molecule corresponding to amino acids 98-106 has been extensively used as a general epitope tag in expression vectors. Many recombinant proteins have been engineered to express the HA tag, which does not appear to interfere with the bioactivity or the biodistribution of the recombinant protein. This tag facilitates the detection, isolation, and purification of the proteins.

The actual HA tag is as follows: 5' TAC CCA TAC GAT GTT CCA GAT TAC GCT 3' or 5' TAT CCA TAT GAT GTT CCA GAT TAT GCT 3' The amino acid sequence is: YPYDVPDYA.

Related Products
Product nameProduct name

Agouti Related Protein (AGRP, or AGRT), is an endogenous antagonist of the melanocortin receptors MC3R and MC4R found in the hypothalamus and exhibits potent orexigenic activity. AGRP can act as a competitive antagonist to proopiomelanocortin (POMC)-derived peptides at the melanocortin-4 receptor (MC4R), and that this homeostatic mechanism is important as a means of coordinating appetite with perceived metabolic requirement. AGRP is upregulated by fasting while intracerebroventricular injections of synthetic AGRP lead to increased appetite and food intake. Thus, AGRP is a powerful orexigenic peptide that increases food intake when ubiquitously overexpressed or when administered centrally.

  • Ilnytska O, et al. (2008) The role of the Agouti-Related Protein in energy balance regulation. Cell Mol Life Sci. 65(17): 2721-31.
  • Pritchard LE, et al. (2005) Agouti-related protein: more than a melanocortin-4 receptor antagonist? Peptides. 26(10): 1759-70.
  • Sttz AM, et al. (2005) The agouti-related protein and its role in energy homeostasis. Peptides. 26(10): 1771-81.
  • Millhauser GL, et al. (2003) Loops and links: structural insights into the remarkable function of the agouti-related protein. Ann N Y Acad Sci. 994: 27-35.
  • Size / Price
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
      Recently Viewed Items