After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat PVRL1 Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
PVRL1cDNA Clone Product Information
Gene_bank_ref_id:XM_236210.5
cDNA Size:1548
cDNA Description:ORF Clone of Rattus norvegicus poliovirus receptor-related 1 DNA.
Gene Synonym:HveC, nectin-1, Pvrl1
Species:Rat
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Poliovirus receptor-related 1 (herpesvirus entry mediator C; nectin-1; CD111), also known as PVRL1 is a cell adhesion molecule belonging to the immunoglobulin superfamily that can bind to virion glycoprotein D (gD) to mediate entry of herpes simplex viruses (HSV) and pseudorabies virus (PRV). CD111/Nectin-1/PVRL1 colocalizes with E-cadherin at adherens junctions in epithelial cells. The disruption of cell junctions can result in the redistribution of nectin-1. To determine whether disruption of junctions by calcium depletion influenced the susceptibility of epithelial cells to viral entry, Madin-Darby canine kidney cells expressing endogenous nectin-1 or transfected human nectin-1 were tested for the ability to bind soluble forms of viral gD and to be infected by HSV and PRV, before and after calcium depletion. It has been revealed that binding of HSV and PRV gD was localized to adherens junctions in cells maintained in normal medium but was distributed, along with nectin-1, over the entire cell surface after calcium depletion. Both the binding of gD and the fraction of cells that could be infected by HSV-1 and PRV were enhanced by calcium depletion. Taken together, CD111/Nectin-1/PVRL1 confined to adherens junctions in epithelial cells is not very accessible to virus, whereas dissociation of cell junctions releases nectin-1 to serve more efficiently as an entry recptor.

References
  • Yoon M, et al. (2002) Disruption of adherens junctions liberates nectin-1 to serve as receptor for herpes simplex virus and pseudorabies virus entry. J Virol. 76(14): 7203-8.
  • Mata M, et al. (2001) HveC (nectin-1) is expressed at high levels in sensory neurons, but not in motor neurons, of the rat peripheral nervous system. J Neurovirol. 7(5): 476-80.
  • Haarr L, et al. (2001) Transcription from the gene encoding the herpesvirus entry receptor nectin-1 (HveC) in nervous tissue of adult mouse. Virology. 287(2): 301-9.
  • Size / Price
    Catalog:RG80244-NM
    List Price: $315.00  (Save $0.00)
    Price:$315.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"