After search, choose a molecule or a kind of categories listed in the left to narrow down your filter. If you have any problems, please contact us!

Quick Order

Text Size:AAA

Rat F11R Gene cDNA Clone (full-length ORF Clone), expression ready, N-Myc-tagged

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
F11RcDNA Clone Product Information
Gene_bank_ref_id:NM_053796.1
cDNA Size:903
cDNA Description:ORF Clone of Rattus norvegicus F11 receptor DNA.
Gene Synonym:Jam1, F11r
Species:Rat
Vector:pCMV3-N-Myc
Restriction Site:
Tag Sequence:Myc Tag Sequence: GAGCAGAAACTCATCTCAGAAGAGGATCTG
Sequence Description:
Shipping_carrier:Each tube contains approximately 10 μg of lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at ambient temperature for three months.
pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Vector Information
 
Vector Name pCMV3-SP-N-Myc
Vector Size 6149bp
Vector Type Mammalian Expression Vector
Expression Method Constiutive, Stable / Transient
Promoter CMV
Antibiotic Resistance Kanamycin
Selection In Mammalian Cells Hygromycin
Protein Tag Myc
Sequencing Primer Forward:T7(TAATACGACTCACTATAGGG)
Reverse:BGH(TAGAAGGCACAGTCGAGG)

pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Physical Map
Schematic of pCMV3-SP-N-Myc (suitable for secretary and membane protein expession) Multiple Cloning Sites

Myc Tag Info

A myc tag can be used in many different assays that require recognition by an antibody. If there is no antibody against the studied protein, adding a myc-tag allows one to follow the protein with an antibody against the Myc epitope. Examples are cellular localization studies by immunofluorescence or detection by Western blotting.

The peptide sequence of the myc-tag is: N-EQKLISEEDL-C (1202 Da). It can be fused to the C-terminus and the N-terminus of a protein. It is advisable not to fuse the tag directly behind the signal peptide of a secretory protein, since it can interfere with translocation into the secretory pathway.

Related Products
Product nameProduct name
Background

Junctional adhesion molecule-A (JAM-A), also known as F11 receptor (F11R) or Cluster of Differentiation 321 (CD321), is a transmembrane protein expressed at tight junctions of epithelial and endothelial cells, as well as on circulating leukocytes. JAM-A protein serves as a serotype-independent receptor for mammalian orthoreoviruses (reoviruses). It is also a ligand for the integrin LFA1, involves in leukocyte transmigration. As a cell adhesion molecule of the immunoglobulin superfamily, JAM-A protein involves in platelet adhesion, secretion and aggregation, and plays a crucial role in inflammatory thrombosis and atherosclerosis. In addition, it may be a potential therapeutic target for breast cancer.

References
  • Guglielmi KM, et al. (2007) Reovirus binding determinants in junctional adhesion molecule-A. J Biol Chem. 282(24): 17930-40.
  • Yeung D, et al. (2008) Decreased junctional adhesion molecule-A expression during blood-brain barrier breakdown. Acta Neuropathol. 115(6): 635-42.
  • Ong KL, et al. (2009) Elevated plasma level of soluble F11 receptor/junctional adhesion molecule-A (F11R/JAM-A) in hypertension. Am J Hypertens. 22(5): 500-5.
  • Size / Price
    Catalog:RG80240-NM
    List Price: $295.00  (Save $0.00)
    Price:$295.00      [How to order]
    Availability2-3 weeks
    Images
      Recently Viewed Items
        Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"