Quick Order

Mouse IVD ORF mammalian expression plasmid, C-His tag

DatasheetSpecific ReferencesReviewsRelated ProductsProtocols
Mouse IVD cDNA Clone Product Information
Gene_bank_ref_id:NM_019826.3
RefSeq ORF Size:1275bp
cDNA Description:Full length Clone DNA of Mus musculus isovaleryl coenzyme A dehydrogenase with C terminal His tag.
Gene Synonym:AI463340, 1300016K07Rik, 6720455E18Rik
Species:Mouse
Vector:pCMV3-C-His
Plasmid:
Restriction Site:
Tag Sequence:His Tag Sequence: CACCATCACCACCATCATCACCACCATCAC
Sequence Description:
Sequencing primers:T7(TAATACGACTCACTATAGGG) BGH(TAGAAGGCACAGTCGAGG)
Promoter:Enhanced CMV mammalian cell promoter
Application:Stable or Transient mammalian expression
Antibiotic in E.coli:Kanamycin
Antibiotic in mammalian cell:Hygromycin
Shipping_carrier:Each tube contains lyophilized plasmid.
Storage:The lyophilized plasmid can be stored at room temperature for three months.
His Tag Info

A polyhistidine-tag is an amino acid motif in proteins that consists of at least five histidine (His) residues, often at the N- or C-terminus of the protein.

Polyhistidine-tags are often used for affinity purification of polyhistidine-tagged recombinant proteins expressed in Escherichia coli and other prokarfyotic expression systems.

Product nameProduct name
Background

Isovaleryl-CoA dehydrogenase, also known as IVD, plays an essential role in processing proteins obtained from the diet. The body breaks down proteins from food into smaller parts called amino acids. Amino acids can be further processed to provide energy for growth and development. Isovaleryl-CoA dehydrogenase helps process a particular amino acid called leucine. Specifically, isovaleryl-CoA dehydrogenase is responsible for the third step in the breakdown of leucine. This step is a chemical reaction that converts a molecule called isovaleryl-CoA to another molecule, 3-methylcrotonyl-CoA. Additional chemical reactions convert 3-methylcrotonyl-CoA into molecules that are used for energy.

References
  • BACHHAWAT BK, et al. (1956) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.
  • Ikeda Y, et al. (1983) Purification and characterization of isovaleryl coenzyme A dehydrogenase from rat liver mitochondria. J Biol Chem. 258(2):1077-85.
  • Tanaka K, et al. (1966) Enzymatic carboxylation of beta-hydroxyisovaleryl coenzyme A. J Biol Chem. 219(2):539-50.
  • Size / Price
    Catalog: MG52067-CH
    List Price:   (Save )
    Price:      [How to order]
    Availability2-3 weeksShipping instructions
    Please note: All products are "FOR RESEARCH USE ONLY AND ARE NOT INTENDED FOR DIAGNOSTIC OR THERAPEUTIC USE"